In the process of __________, the nucleotide sequence in a mRNA molecule specifies the amino acid...
Homework Answers
Answer - (b)
Explanation- In the process of translation, the nucleotide sequence in an mRNA molecule specifies the amino acid sequence of a protein which refers that after transcription which is the conversion of DNA to RNA, the translation process occurs in which protein is synthesized.
Thank you
Add Answer to:
In
the process of __________, the nucleotide sequence in a mRNA
molecule specifies the amino acid...
1. If an mRNA carried a mutation that caused a difference in the amino acid sequence...
1. If an mRNA carried a mutation that caused a difference in the amino acid sequence relative to the wild-type gene product, would the translation machinery recognize this and correct it? Explain. 2. Synthesis of mRNA (transcription) and protein (translation) proceed in an ordered manner, from one end of the molecule to another. What is the polarity of each of these processes? (Use the terms 5', 3', amino, carboxyl.)
1. The following nucleotide sequence is found on a strand of mRNA. Give the altered amino...
1. The following nucleotide sequence is found on a strand of mRNA. Give the altered amino acid sequence of the protein that will be found in each of the following mutations. Please also list an anticipated phenotypical change(s) (nonsense, missense, frameshift, addition/subtraction of amino acid etc.) (1 pts each) Second position Nucleotide #: 1 4 7 10 13 U UUU 16 19 22 UCU UAU UGU UUC UAC UAA UUA UUD RNA: 5-AUG ACC GGC AAU CAA CUA UAU UGA-3'...
What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of...
What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of amino acids using the three-letter abbreviations, separated by hyphens (e.g., Met-Ser-Thr-Lys-Gly).
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the...
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of...
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
Determine if the following words describe transcription, translation, or both transcription and translation. Nucleotide Ribosome Amino...
Determine if the following words describe transcription, translation, or both transcription and translation. Nucleotide Ribosome Amino acid mRNA Nucleus DNA
Which RNA molecule carries the nucleotide sequence responsible for the amino acid sequence in proteins? messenger...
Which RNA molecule carries the nucleotide sequence responsible for the amino acid sequence in proteins? messenger RNA transfer RNA ribosomal RNA translator RNA
Which mRNA sequence specifies the tripeptide with the sequence gly-ala-leu GAGAGCCCC CUCUCGGGG CCGCGAGCC CCCCGAGAG OGGGGCUCUC Question...
Which mRNA sequence specifies the tripeptide with the sequence gly-ala-leu GAGAGCCCC CUCUCGGGG CCGCGAGCC CCCCGAGAG OGGGGCUCUC Question 22 1.5 pts are RNA-protein complexes that catalyze the polymerization of amino acids bound to aminoacyl-tRNA molecules. Transcription factors Splicesomes Exons Codons Ribosomes
1. The following nucleotide sequence is found on a strand of mRNA. Give the altered amino acid sequence of the protein that will be found in each of the following mutations. Please also list an anticipated phenotypical change(s) (nonsense, missense, frameshift, addition/subtraction of amino acid etc.) (1 pts each) Second position Nucleotide #: 1 4 7 10 13 U UUU 16 19 22 UCU UAU UGU UUC UAC UAA UUA UUD RNA: 5-AUG ACC GGC AAU CAA CUA UAU UGA-3'...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
Determine if the following words describe transcription, translation, or both transcription and translation. Nucleotide Ribosome Amino acid mRNA Nucleus DNA
Which RNA molecule carries the nucleotide sequence responsible for the amino acid sequence in proteins? messenger RNA transfer RNA ribosomal RNA translator RNA
Which mRNA sequence specifies the tripeptide with the sequence gly-ala-leu GAGAGCCCC CUCUCGGGG CCGCGAGCC CCCCGAGAG OGGGGCUCUC Question 22 1.5 pts are RNA-protein complexes that catalyze the polymerization of amino acids bound to aminoacyl-tRNA molecules. Transcription factors Splicesomes Exons Codons Ribosomes
Most questions answered within 3 hours.
-
The English mathematician John Kerrich tossed a coin
10,000 times and obtained 5067 heads.
a. calculate...
asked 9 minutes ago -
13. Use the Student's t-distribution to find the t-value for
each of the given scenarios. Round...
asked 2 minutes ago -
Explain the nutrition assessment for the lower gastrointestinal
tract, including the components of client history, anthropometric...
asked 1 minute ago -
1.Marc has tried to quit heroin seven times only to
relapse each and every time. Marc...
asked 10 minutes ago -
A process has an input as the flow q gal/min, and an
output temperature T Fahrenheit. Initially,...
asked 15 minutes ago -
A sample of 30 patients in a doctor's office showed that they
had to wait an...
asked 21 minutes ago -
Please write 6 to 10 paragraphs on the risks associated with
digging an underground hole.
Write...
asked 27 minutes ago -
The function x = (7.9 m) cos[(4πrad/s)t + π/3 rad] gives the
simple harmonic motion of...
asked 28 minutes ago -
A sample of steam with a mass of 0.501 g at a temperature of 100
∘C...
asked 1 hour ago -
I1(t) and I2(t) describe the intensity of two
light waves.
I1(t)= 10sin(30t+π/4)
I2(t)=
10sin(30.4t+π)
Assume that...
asked 56 minutes ago -
True or False: Spinal nerves emerging from the vertebral column
are ONLY motor OR sensory.
Select...
asked 43 minutes ago -
last question i found wrong so downvoted so dont copy
paste or dont try if you...
asked 38 minutes ago