Homework Answers
Ans 21-) GGGGCUCUC is the correct option.
as the mRNA codon GGG encodes for glycine. mRNA codon GCU encodes for alanine. MRNA codon CUC codes for leucine.
Ans 22-) Ribosomes is the correct option.
Ribosome is generally, a ribonucleoprotein which is formed from the complex of protein and RNA. Ribosome has two subunits. Ribosomal smaller subunit will bind to mRNA while the larger subunit will bind to the aminoacyl tRNA
Add Answer to:
Which mRNA sequence specifies the tripeptide with the sequence gly-ala-leu GAGAGCCCC CUCUCGGGG CCGCGAGCC CCCCGAGAG OGGGGCUCUC Question...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Suppose part of the amino acid sequence of a protein is N... Gly - Ala -...
Suppose part of the amino acid sequence of a protein is N... Gly
- Ala - Pro - Arg - Lys ...C. Which of the following amino acid
sequences could result from a frameshift mutation (+1 or -1) in the
part of the gene that encodes this sequence of amino acids?
Ο N... Gly - Ala - Asn - Ser - Leu ...C Ο Ν...Αla - Ala - Arg - Pro - Lys...C Ο Ν...Gly - Gly - Thr -...
3. A small peptide has the amino acid sequence Phe-Leu-Tyr-Ala-Leu-Gly-Glu. A shorter variant of this peptide...
3. A small peptide has the amino acid sequence Phe-Leu-Tyr-Ala-Leu-Gly-Glu. A shorter variant of this peptide was discovered that had the sequence Phe-Leu-Tyr-Ala; it was demonstrated that this shorter peptide was due to a single base substitution in the second Leu codon. What type of mutation (missense, nonsense, frameshift) gave rise to this shorter peptide? Which of the six possible Leu codons was used in the synthesis of the original (long) peptide (can you eliminate some as possibilities)?
Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, ch...
Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, choose only one If there are fewer than 8 amino acids in the peptide, leave the corresponding codons blank. Enter your answer in ALL CAPS, ie, "ATG" not "atg" Third base (3" end) First base (5' end) Second baseUCAG Phe Phe Leu Leu SerSer Ser Ser U Leu Leu...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A....
If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A. CAU • B. GTA C.CAT • D. GUA What are the 2 main parts of Protein synthesis? • A. Transcribing and Translating B. Prescription and Translation . C. Transcription and Translation D. Transcribing and Translating Why must an mRNA copy be made for Protein Synthesis? A. DNA must stay inside the nucleus. B. Ribosomes cannot read DNA, only RNA. C. DNA is too degenerate...
22. What are the roles of Dicer and RISC in the function of miRNAs? Dicer RISC...
22. What are the roles of Dicer and RISC in the function of miRNAs? Dicer RISC 23. Describe the concepts of primary, secondary, tertiary and quaternary protein structure 24. Here is a short sequence of codons. AUG CAU UGU UUU Write out the amino acids this sequence of codons encodes. Now add an insertion mutation of your choosing in the first codon and write out the new mutant sequence. What are the first four amino acids encoded by this mutant...
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c....
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3' end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of...
Write down the mRNA sequence for: start-val-ala-thr-thr-leu-tyr-cys-gly-arg-stop start-lys-asn-gly-phe-his-thr-arg-pro-gln-stop start-met-thr-asn-lys-pro-gln-ser-leu-arg-stop
Write down the mRNA sequence for: start-val-ala-thr-thr-leu-tyr-cys-gly-arg-stop start-lys-asn-gly-phe-his-thr-arg-pro-gln-stop start-met-thr-asn-lys-pro-gln-ser-leu-arg-stop
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Suppose part of the amino acid sequence of a protein is N... Gly
- Ala - Pro - Arg - Lys ...C. Which of the following amino acid
sequences could result from a frameshift mutation (+1 or -1) in the
part of the gene that encodes this sequence of amino acids?
Ο N... Gly - Ala - Asn - Ser - Leu ...C Ο Ν...Αla - Ala - Arg - Pro - Lys...C Ο Ν...Gly - Gly - Thr -...
Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, choose only one If there are fewer than 8 amino acids in the peptide, leave the corresponding codons blank. Enter your answer in ALL CAPS, ie, "ATG" not "atg" Third base (3" end) First base (5' end) Second baseUCAG Phe Phe Leu Leu SerSer Ser Ser U Leu Leu...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A. CAU • B. GTA C.CAT • D. GUA What are the 2 main parts of Protein synthesis? • A. Transcribing and Translating B. Prescription and Translation . C. Transcription and Translation D. Transcribing and Translating Why must an mRNA copy be made for Protein Synthesis? A. DNA must stay inside the nucleus. B. Ribosomes cannot read DNA, only RNA. C. DNA is too degenerate...
22. What are the roles of Dicer and RISC in the function of miRNAs? Dicer RISC 23. Describe the concepts of primary, secondary, tertiary and quaternary protein structure 24. Here is a short sequence of codons. AUG CAU UGU UUU Write out the amino acids this sequence of codons encodes. Now add an insertion mutation of your choosing in the first codon and write out the new mutant sequence. What are the first four amino acids encoded by this mutant...
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3' end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
Most questions answered within 3 hours.
-
You are attempting to calculate a firm’s free cash flow to
equity. You know the following...
asked 22 minutes ago -
the following reaction occurs in a balloon containing
N2O2 gas
N2O4(g)=2NO2(g)
will the volume of the...
asked 57 minutes ago -
answer the questions throughout this program
public class Day implements Comparable {
Private Boolean atWork;...
asked 1 hour ago -
This is C++ code for parking fee management program
#include <iostream>
#include <iomanip>
using namespace std;...
asked 1 hour ago -
The free energy change for the following reaction at 25 °C, when
[Sn2+] = 1.17 M...
asked 3 hours ago -
An MNE is this kind of industry when competition in one country
is essentially independent of...
asked 4 hours ago -
. For this set of questions, determine what
proportion of a normal distribution is located betweeneach...
asked 5 hours ago -
A college student is employed as a door-to-door newspaper
salesman. Historical data suggests that the student...
asked 6 hours ago -
MATLAB HW 11 problem using Switch Case and Input commands
Write a script file that calculates...
asked 5 hours ago -
Considering gravitational time dilation, calculate the time that
passes in Earth’s surface while 1 hour passes...
asked 6 hours ago -
Minitab Problem: Take the Lake Hume June rainfall data and find
use the processes outlined in...
asked 7 hours ago -
X Company is trying to decide whether to continue using old
equipment to make Product A...
asked 7 hours ago