Why are there multiple results returned when you input a sequence into BLAT or BLAST? How...
Why are there multiple results returned when you input a sequence into BLAT or BLAST? How do you know which is most relevant? Does that make the others irrelevant ?
Homework Answers
BLAST = Basic Local Alignment Search Tool
It is a software tool used to search unknown sequences using
sequence similarity/identity.
When a BLAST search is performed, several results are
obtained.
These results represent multiple sequences from different organisms
that exhibit sequence similarity with the query sequence.
If the query sequence is conserved, the number of results will be
high.
Among the BLAST results, we have to choose the result which has maximum similarity/identity and sequence coverage.
It does not make other results irrelevant. It just shows that such sequences are also found in other organisms.
Add Answer to:
Why are there multiple results returned when you input a
sequence into BLAT or BLAST? How...
Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an...
Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F 5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R 5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...
Why and when to use multiple? How to assess whether the valuation results make sense in...
Why and when to use multiple? How to assess whether the valuation results make sense in terms of the EV/EBIDTA multiple.
please answer questions with the following BLAST results For your GenBank assignment due at 12 noon on Thursday May...
please answer questions with the following BLAST results
For your GenBank assignment due at 12 noon on Thursday May 23rd (don't forget, I will not accept late papers): 1. Dr. Monsen-Collar will tell you the number of a sequence posted on Canvas. Copy the entire sequence and use it in a BLAST search to determine what gene the sequence is. Answer the following questions: A. What gene is your unknown sequence likely to be? How do you know it's a...
Discussion W1 - Multiple Intelligences Watch Howard Gardner's video on Multiple Intelligences and answer the following...
Discussion W1 - Multiple Intelligences Watch Howard Gardner's video on Multiple Intelligences and answer the following questions: 1. How is the concept of multiple intelligences relevant to the world of business? How is it relevant to leading others? 2. Which type of intelligence that Gardner speaks to do you feel is most important in the business world to have, and why?
Note that the sequence a(n) = Crn is a constant multiple of the well-known geometric sequence you...
Note that the sequence a(n) = Crn is a constant multiple of the well-known geometric sequence you studied in Calculus II. We know that the behaviour of this sequence depends on both r and the sign of C. Read the relevant section in your Calculus text to create a table which discusses the different types long-term behavior, limn→∞ a(n), you observe. Question: Create a table which discusses the different types long-term behavior, limn→∞ a(n), you observe.
-how do you not know you are not activating multiple sub population when you are activating...
-how do you not know you are not activating multiple sub population when you are activating one subpopulation. what experiments would you do to verify this.
Can you explain how do you know when to add probabilities or multiple probabilities?
Can you explain how do you know when to add probabilities or multiple probabilities?
In detail, please explain how to do D and E 15.1 The results of a multiple...
In detail, please explain how to do D and E
15.1 The results of a multiple regression based on nine observations are shown in Table 15.11. Based on these results answer the following questions: a. What percentage of variance is explained by the regression? TABLE 15.11 Results of a Multiple Regression Analysis 1.3 2.7 0.5 5.0 3.6 1.8 0.6 8.3 Intercept 75.3 Coefficient of multiple correlation 0.95 Standard deviation of errors 12.0 F-value 14. b. Is the regression significant at...
In looking through sequence information from the first assignment, you may have noticed there was no...
In looking through sequence information from the first assignment, you may have noticed there was no ONE TRUE SEQUENCE, and that there were quite a few ways to present the information with different databases and multiple entries for each database. Of most importance to us right now is understanding why it matters if the sequence being described is genomic or if it was an mRNA - and if it was an mRNA – was it a splice-site variant. A) What’s...
How can you tell which of the two following equations to use when solving problems and...
How can you tell which of the two following equations to use
when solving problems and why do the two different equations
exist?
Why does one have moles and the other mass? How does this affect
how we find internal energy for instance? I know that U= Q- W but
wouldn't know which Q to use.
CynAT specific mass change in heat added heat temperature
please answer questions with the following BLAST results
For your GenBank assignment due at 12 noon on Thursday May 23rd (don't forget, I will not accept late papers): 1. Dr. Monsen-Collar will tell you the number of a sequence posted on Canvas. Copy the entire sequence and use it in a BLAST search to determine what gene the sequence is. Answer the following questions: A. What gene is your unknown sequence likely to be? How do you know it's a...
Discussion W1 - Multiple Intelligences Watch Howard Gardner's video on Multiple Intelligences and answer the following questions: 1. How is the concept of multiple intelligences relevant to the world of business? How is it relevant to leading others? 2. Which type of intelligence that Gardner speaks to do you feel is most important in the business world to have, and why?
In detail, please explain how to do D and E
15.1 The results of a multiple regression based on nine observations are shown in Table 15.11. Based on these results answer the following questions: a. What percentage of variance is explained by the regression? TABLE 15.11 Results of a Multiple Regression Analysis 1.3 2.7 0.5 5.0 3.6 1.8 0.6 8.3 Intercept 75.3 Coefficient of multiple correlation 0.95 Standard deviation of errors 12.0 F-value 14. b. Is the regression significant at...
How can you tell which of the two following equations to use
when solving problems and why do the two different equations
exist?
Why does one have moles and the other mass? How does this affect
how we find internal energy for instance? I know that U= Q- W but
wouldn't know which Q to use.
CynAT specific mass change in heat added heat temperature
Most questions answered within 3 hours.
-
Which of the following pairs of ions have the same electron
configuration?
I: Br− and Se2−...
asked 2 hours ago -
The Foremost Composite Materials Company is planning a two-day
sales conference for October 19-20. The conference...
asked 2 hours ago -
3) Illustrate the observed pattern of relatedness of organisms
versus adaptations to specific conditions. This means...
asked 3 hours ago -
In winter a lake has a 0.35 m thick ice layer over 1.10 m of
water....
asked 4 hours ago -
Assuming the following has been encrypted with a Vigenere cipher
below, use the method(s) and assumptions...
asked 4 hours ago -
How would I use switch statements to write a program that will
take an input of...
asked 4 hours ago -
Imagine a reaction in which methane gas combusts at a constant
pressure of 1 atm and...
asked 4 hours ago -
Two parallel wires (each 12 m in length) are separated by a
distance of 0.065 m...
asked 4 hours ago -
Suppose there were three masses at the corner of uniform
equilateral triangle. The masses are m1...
asked 4 hours ago -
Situation: A building that is 618 m above the ground floor. How
many times would a...
asked 4 hours ago -
help me and discuss one successful and one
unsuccessful international company/busines in Indonesia.whyit
succeed and why...
asked 4 hours ago -
I- Choose the best answer
Which of the following statements about the structure and
packaging of...
asked 4 hours ago