This question refers to the mRNA sequence below:
5' - A G C U G A U G G G C U G G U G C C G A G A A A G U U A G G U A A - 3'
As this mRNA is translated, the fifth codon is ___. Fill in the blank with the correct codon without any spaces, and nothing else so that Moodle can grade this question correctly.
We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
This question refers to the mRNA sequence below: 5' - A G C U G A...
This question refers two mRNA sequences below: a) 5' - A G C U G A U G G G C U G G U G C C G A G A A A G U U A G G U A A - 3' b) 5'-A A C G A A U A U G U U A A U C G U A G C C A C C U G G U U C A G C...
C++: Translating mRNA sequence help Homework Description Codon 1 You are working in a bioinformatics lab studying messenger RNA (mRNA) sequences. mRNA is a sequence of the nucleotide bases (Adenine, Cytosine, Guanine, and Uracil) that conveys information stored in DNA to Ribosomes for translation into proteins. The bases in the sequences are denoted by the first letters of the nucleotide bases (e.g. A, C, G, and U). A sequence of mRNA is made up of hundres to thousands of nucleotide...
The map below was constructed using information from an interrupted mating experiment. Str# refers to the strain number from which the data were obtained. The strains that are referenced by the Str#'s on the map are considered to be strains. The units for the map distance values on this map are Assume that four genes were transferred by each strain in the interrupted mating experiment. Based on this map, list in order of transfer (first to last) the genes transferred...
Below is a partial mRNA sequence. Use it to answer the following questions. 5 - UGGUCGGCGAGAACGAAAGCGC - 3 The amino acids in the original partial sequence (N-term-...V-G-E-N-E-S...-C-term) have little to no impact on protein structure and function, with the exception of serine. Phosphorylation of the serine residue is required for normal function of the protein. Given this information, which reversion mutation(s) in the gene would restore the normal function of the entire protein? Select the four correct answers. Deletion of...
QUESTION 27 Assume the sequence below shows the 5' end of a mRNA isolated from bacteria. Determine the partial amino acid sequence of the protein coded by this mRNA. Type your answer using one-letter amino acid sequence with no spaces in between and starting with the N terminus. 5'GCCAUCAUGCUAGGAGGUUCACCGGAUGGGGUCACAGACGGCG.......
The image below is a mRNA message. Please draw a ribosome translating the message below. Draw the ribosome with P-site ON CODON 3. In your image draw the ribosome immediately prior to it translocating to the next codon. It is important to draw tRNAs, amino acids, etc in the correct location. Do not forget to label all of the following: A-site (and tRNA), P-site (and tRNA), E-site (and tRNA), large subunit, small subunit, all amino acids in their correct positions...
Question 16: The following shows the same segment of DNA that was shown above in Question 15, however, this DNA sequence is for the mutant allele for the collagen type 1 gene. This mutated allele is responsible for a genetic skeletal disorder called osteogenesis imperfecta. 5' ATGCTATGGGCATGATCCCAGCCT 3' 3' TACGATACCCGTACTAGGGTCGGA 5' Answer the following questions: (a) If the bottom strand serves as the DNA template for transcription, what is the resulting mRNA sequence for this mutant allele? The mutated mRNA...
Follow the instructions below to answer questions about Replication, Transcription & Translation. 3’- T A C A C C G G T C A G G T G A T C -5’ A. Imagine that the sequence shown represents one strand of a gene sequence. What would be the sequence of the complementary strand of DNA? Write out your answer, indicating correct polarity (5' and 3' ends) on your new strand. (1.5 points) B. Now imagine that the new strand...
Question 9: The genetic code is read in groups of three nucleotides, called codons, in mRNA that specifies for a particular amino acid. tRNA molecules act as the amino acid carriers that by correctly pairing with the codon on mRNA can deliver the correct amino acid to the ribosome during translation. At the tip of each tRNA molecule is a group of three nucleotides called an anticodon and at the other end is where the corresponding amino acid is attached...
BONUS (10 points, 2 points each): Given below is a sequence of mRNA that is transcribed from a structural and mRNA: AUG CGC GOA UCC CCC ACC AGA ACG GAX UGA-3 G-C 1. Using the codon chart provided below, write down the predicted amino acid sequence of the protein the produced from this mRNA 3-UAC GCG EXU AGG GGG UGG UCU UGC COU 2). Write down the DNA sequence of the structural pene from which this mRNA sequence is transcribed...