Please help I have a quiz to submit in a couple of minutes and I don't...
Please help I have a quiz to submit in a couple of minutes and I don't understand these questions!
1. What is the charge on arginine at pH = 8? ( I think its +1 just need to make sure)
+1
+2
-1
0
2. What is the charge on arginine at pH = 10? (I think its -1 just need to make sure)
0
+1
+2
-1
2. What is the charge on the following polypeptide at pH = 7? (I think this is either +1 or 0 but not sure either)
ala-gly-asn-asp-lys-ser-val-his
0
+1
-1
+2
-2
Homework Answers
1.Charge of Arginine at pH -8 is +1
2.charge of Arginine at pH -10 is -1
3.charge of the following peptide at pH-7 is 0
Add Answer to:
Please help I have a quiz to submit in a couple of minutes and I
don't...
please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A...
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
PLEASE HELP OCHEM QUESTION 1. In the following protein, identify the type of bonding or interaction...
PLEASE HELP OCHEM QUESTION
1. In the following protein, identify the type of bonding or interaction that is responsible for holding the two peptide chains together at each amino acid pair, above (A) and below (B). Gly - Ala - Ser - Cys - Val - Asp - Leu - Thr - His - Ile-Tyr-Glu - Phe - Lys - Cys - Met - Asn Val - Leu -Gin-Cys - Pro-Lys - Met - Tyr - Asp -Phe-Asn-Lys - Ile...
3. A protein contains the following amino acids: O ALA 4 GLN 1 LEU 3 ARG...
3. A protein contains the following amino acids: O ALA 4 GLN 1 LEU 3 ARG 4 GLU 4 LYS 4 ASN 5 GLY O MET 1 ASP 1 HIS 2 PHE 4 ILE 4 PRO 8 SER 5 THR 1 TRP 2 TYR 2 VAL BGYS. a) What is its net charge at pH 1? b) What is its net charge at PH 13? c) Calculate the pl. 4. In what order would the amino acids GLU, LYS, and...
i think there are two right answers? From the partial nucleotide sequence given below, what peptides could be encoded?...
i think there are two right answers?
From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro
From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА...
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-
Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-Glu__Leu-Glu-Val-Glu-Leu-Ser__Ser-Ile-Asn-Cys-Glu__His-Glu-__His-Ala-Pro-Pro-Ile-Leu-Tyr__Glu-Ala-Thr-Ser__Val-Ala-Asn-Ile-Leu-Leu-Ala__Cys-Ala-Lys-Glu-__Ala-Asn-Asp__Pro-Glu-Cys-Ala-Asn__Pro-Ile-Glu__Trp-Ile-Thr-His__Phe-Arg-Ile-Glu-Asp__Cys-His-Glu-Glu-Ser-Glu-Cys-Ala-Lys-Glu__Ile-Cys-Glu__Cys-Arg-Glu-Ala-Met__Glu-Val-Glu-Arg-Tyr-Asp-Ala-Tyr__Ala-Asn-Asp__Ser-His-Glu__Ile-Ser__Asp-Glu-Val-Ala-Ser-Thr-Ala-Thr-Glu-Asp__Thr-His-Ala-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu-Ser__Leu-Ile-Lys-Glu__His-Glu-Ala-Arg-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu__Ser-Leu-Glu-Glu-Pro__Ala-Pro-Asn-Glu-Ala__Ser-Glu-Val-Glu-Arg-Glu__Trp-Glu-Ile-Gly-His-Thr__Gly-Ala-Ile-Asn__Trp-Ile-Leu-Leu__Ala-Arg-Ile-Ser-Glu__Ile-Phe__His-Glu__Lys-Glu-Glu-Pro-Ser__Thr-His-Ile-Ser__Glu-Ala-Thr-Ile-Asn-Gly__Pro-Ala-Thr-Thr-Glu-Arg-Asn__Tyr-Glu-Thr__Ile-Phe__His-Glu__Trp-Trp-Trp-Trp-Ile-Ile-Ile-Ile-Ile-Leu-Leu-Leu-Leu-Leu-Ser-Ser-Ser-Ser__Cys-His-Ala-Asn-Gly-Glu__Ile-Asn__His-Ile-Ser__Leu-Ile-Phe-Glu-Ser-Thr-Tyr-Leu-Glu__His-Glu__Cys-Ala-Asn__Ser-Thr-Ile-Leu-Leu__Arg-Glu-Met-Ala-Ile-Asn__His-Glu-Ala-Leu-Thr-His-Tyr__Ser-Ala-Ser-Ser-Tyr__Ala-Asn-Asp__Ala-Leu-Arg-IleGly-His-Thr 1.) Write out the 1 letter amino acid abbreviation for each of the three-letter amino acid abbreviated words listed in the given sequence. The __ indicates a space in between the words. Use www.expasy.org and other bioinformatic tools to generate the following bioinformatic data for the given polypeptide sequence. You must give the name and link to the program you used to generate the data: 2.) Compute the pI and Mw (isoelectric point and molecular mass, respectively) of...
This is the full question. Please let me know what is missing?3. If the...
This is the full question. Please let me know what is missing
?3. If the following polypeptide was digested by trypsin, give the resulting peptides. Glu-Gly-Val-Phe-Ser-Ala-Arg-Ser-Ala-Phe-Lys-Pro-lle-Cys-Lys-Trp-Asp-Val-Met 4. For the following peptide, predict all the b-and y-ion series (with its m/z), under acidic analysis conditions. Ser-Phe-Tyr-Cys-Trp-Ala-Arg The first and last entries have been started. Use the residue amu from slide 28 (Mass Spec II). [For the b-ions start at the top, from Ser. For the y-ions, start at the bottom, from Arg.)
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
10. The peptide shown has the amino acid sequence: A. Val-Ser-Ile-Glu-Lys B. Lys-Glu-Ile-Ser-Val C. Thr-Asp-Leu-Gln-Arg D....
10. The peptide shown has the amino acid sequence: A. Val-Ser-Ile-Glu-Lys B. Lys-Glu-Ile-Ser-Val C. Thr-Asp-Leu-Gln-Arg D. Val-Asp-Ile-Glu-Arg 11. Which of the following describes the entire three- dimensional structure of a single polypeptide? A. Secondary structure B. Quaternary structure C. Tertiary structure D. Primary structure 12. What is the primary driving force in the formation of protein tertiary structure? A. Energy released when additional ion pairs are formed. B. The exclusion of non-polar substances from aqueous solution. C. The formation of...
If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A....
If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A. CAU • B. GTA C.CAT • D. GUA What are the 2 main parts of Protein synthesis? • A. Transcribing and Translating B. Prescription and Translation . C. Transcription and Translation D. Transcribing and Translating Why must an mRNA copy be made for Protein Synthesis? A. DNA must stay inside the nucleus. B. Ribosomes cannot read DNA, only RNA. C. DNA is too degenerate...
please explain how to solve this problem, the answer
is provided
9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...
PLEASE HELP OCHEM QUESTION
1. In the following protein, identify the type of bonding or interaction that is responsible for holding the two peptide chains together at each amino acid pair, above (A) and below (B). Gly - Ala - Ser - Cys - Val - Asp - Leu - Thr - His - Ile-Tyr-Glu - Phe - Lys - Cys - Met - Asn Val - Leu -Gin-Cys - Pro-Lys - Met - Tyr - Asp -Phe-Asn-Lys - Ile...
3. A protein contains the following amino acids: O ALA 4 GLN 1 LEU 3 ARG 4 GLU 4 LYS 4 ASN 5 GLY O MET 1 ASP 1 HIS 2 PHE 4 ILE 4 PRO 8 SER 5 THR 1 TRP 2 TYR 2 VAL BGYS. a) What is its net charge at pH 1? b) What is its net charge at PH 13? c) Calculate the pl. 4. In what order would the amino acids GLU, LYS, and...
i think there are two right answers?
From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro
From the partial nucleotide sequence given below, what peptides could be encoded? 5-GCCUCCAAAccccucCA-3' Choose one or more: A. Ala-Ser-Lys-Pro-Leu B. Leu-Gln-Thr-Pro-Pro C. Pro-Pro-Asn-Pro-Ser D. Lys-Pro-Ser-Gly-Met E. Met-Arg-His-Asp-Pro
What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...
This is the full question. Please let me know what is missing
?3. If the following polypeptide was digested by trypsin, give the resulting peptides. Glu-Gly-Val-Phe-Ser-Ala-Arg-Ser-Ala-Phe-Lys-Pro-lle-Cys-Lys-Trp-Asp-Val-Met 4. For the following peptide, predict all the b-and y-ion series (with its m/z), under acidic analysis conditions. Ser-Phe-Tyr-Cys-Trp-Ala-Arg The first and last entries have been started. Use the residue amu from slide 28 (Mass Spec II). [For the b-ions start at the top, from Ser. For the y-ions, start at the bottom, from Arg.)
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
10. The peptide shown has the amino acid sequence: A. Val-Ser-Ile-Glu-Lys B. Lys-Glu-Ile-Ser-Val C. Thr-Asp-Leu-Gln-Arg D. Val-Asp-Ile-Glu-Arg 11. Which of the following describes the entire three- dimensional structure of a single polypeptide? A. Secondary structure B. Quaternary structure C. Tertiary structure D. Primary structure 12. What is the primary driving force in the formation of protein tertiary structure? A. Energy released when additional ion pairs are formed. B. The exclusion of non-polar substances from aqueous solution. C. The formation of...
If a DNA strand has a sequence GTA, what will be the tRNA anticodon sequence? A. CAU • B. GTA C.CAT • D. GUA What are the 2 main parts of Protein synthesis? • A. Transcribing and Translating B. Prescription and Translation . C. Transcription and Translation D. Transcribing and Translating Why must an mRNA copy be made for Protein Synthesis? A. DNA must stay inside the nucleus. B. Ribosomes cannot read DNA, only RNA. C. DNA is too degenerate...
Most questions answered within 3 hours.
-
Spacely Sprockets is evaluating the construction of a new plant
on land the company purchased for...
asked 35 minutes ago -
1. Consider a linear regression model of y on K regressors and
an intercept.
(i) Describe...
asked 36 minutes ago -
Enter a balanced equation for the reaction between hydrochloric
acid and sodium sulfite.
Express your answer...
asked 41 minutes ago -
Give a regular expression describing the language
{x | x ∈ Σ* and x does not...
asked 42 minutes ago -
Masses of 1.0 kg, 2.0 kg, and 3.0 kg are each separately subject
to a net...
asked 51 minutes ago -
The mode of philosophical argumentation and thought. How do
philosophers think and write? What is important...
asked 56 minutes ago -
At the beginning of the unit, you were asked whether you thought
it was appropriate or...
asked 1 hour ago -
Calculate the grams of carbon in 9.32 x 10+23 molecules of
benzene (C6H6).
asked 1 hour ago -
A 5-year Treasury bond has a 4.95% yield. A 10-year Treasury
bond yields 6.6%, and a...
asked 1 hour ago -
suppose you own a chain of five restaurants in
downtown Vancouver. as the manager, you want...
asked 1 hour ago -
Here are summary statistics for randomly selected weights of
newborn girls:
nequals=225x overbarxequals=28.7hg, sequals=7.5hg. Construct a...
asked 1 hour ago -
Q) Simplify the following functions and implement them with two-
level NAND gate circuits:
a) F(A,B,C,D)=...
asked 1 hour ago