a) name 3 types of RNA and what's they're function? b) Draw an mRNA strand that...
a) name 3 types of RNA and what's they're function?
b) Draw an mRNA strand that is complementary to the DNA strand AATTGC, circle the nucleotide.
Homework Answers
Add Answer to:
a) name 3 types of RNA and what's they're function?
b) Draw an mRNA strand that...
6. The three types of RNA involved in gene expression are mRNA tRNA complimentary strand of...
6. The three types of RNA involved in gene expression are mRNA tRNA complimentary strand of RNA during gene expression is this strand of RNA is being synthesized, each new nucleotide is being added to the strand via a bond formed at carbon number the nucleotide at the end of the RNA. The enzyme invoved involved in transcribing a When , and rRNA of the ribose ring present on
Assuming you have this strand: 3’-TGAATC-5’ What would be the: a) Complementary strand b) mRNA strand...
Assuming you have this strand: 3’-TGAATC-5’ What would be the: a) Complementary strand b) mRNA strand c) nucleotide tRNA sequence
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA...
7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA is transcribed from the complementary strand (not shown) to this DNA. What will be the sequence of the pre-mRNA (make sure you label the 5' and 3'ends)? BUCO BUCO DUCO DUCO B. The lowercase letters in the sequence above represent an intron. Starting at the ATG, what would be the protein sequence once the intron is properly removed? с Two mutations occurred. 1) A...
1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The...
1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The point mutation in the gene results in the MRNA sequence AUGCCGGACUUU. What are the amino acid sequence for the normal and mutant proteins? Say, with an explanation whether you expect this to be a silent mutation. b. Why is DNA polymerase said to be template-directed? If a RNA had the nucleotide sequence 5'-AUGCCAUAACGAUACCCCAGUC-3', what was the sequence of the DNA strand that was transcribed...
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...
Answer The following Please, Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC...
Answer The following Please,
Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...
8. The strand of the RNA of mRNA is held together by A) hydrogen bonds. B)...
8. The strand of the RNA of mRNA is held together by A) hydrogen bonds. B) metallic bonds. C) dipole-dipole interactions. D) ionic bonds. E) sugar-to-phosphate bonds.
6. The three types of RNA involved in gene expression are mRNA tRNA complimentary strand of RNA during gene expression is this strand of RNA is being synthesized, each new nucleotide is being added to the strand via a bond formed at carbon number the nucleotide at the end of the RNA. The enzyme invoved involved in transcribing a When , and rRNA of the ribose ring present on
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA is transcribed from the complementary strand (not shown) to this DNA. What will be the sequence of the pre-mRNA (make sure you label the 5' and 3'ends)? BUCO BUCO DUCO DUCO B. The lowercase letters in the sequence above represent an intron. Starting at the ATG, what would be the protein sequence once the intron is properly removed? с Two mutations occurred. 1) A...
1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The point mutation in the gene results in the MRNA sequence AUGCCGGACUUU. What are the amino acid sequence for the normal and mutant proteins? Say, with an explanation whether you expect this to be a silent mutation. b. Why is DNA polymerase said to be template-directed? If a RNA had the nucleotide sequence 5'-AUGCCAUAACGAUACCCCAGUC-3', what was the sequence of the DNA strand that was transcribed...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...
Answer The following Please,
Name: Date: Transcription/Translation Practice Worksheet 1. Use the following DNA strand: TAC GTC ACG AGA TGA GTT ATC ATT A. What is the mRNA synthesized from the DNA strand? B. What is the amino acid sequence that is then translated from this mRNA strand? 2. Use the following DNA stand: TAC TTG GCC ACG GAC TAA CAT GCA A. What is the complementary DNA strand of the above DNA strand? B. Using the complementary DNA strand,...
8. The strand of the RNA of mRNA is held together by A) hydrogen bonds. B) metallic bonds. C) dipole-dipole interactions. D) ionic bonds. E) sugar-to-phosphate bonds.
Most questions answered within 3 hours.
-
Which for loop is implemented correctly in Java?
Group of answer choices
for (i = 0...
asked 29 minutes ago -
Required information
[The following information applies to the questions
displayed below.]
In 2019, Alliant Corporation acquired...
asked 47 minutes ago -
How much must I invest today if I want to withdraw 1/3 of my
original investment...
asked 2 hours ago -
What is meant by a “term premium”?
What can explain such a premium? Is it a...
asked 4 hours ago -
23. Which molecule has only covalent bonds? A. CO2 B. Al2O3 C.
Mg3N2
24. The octet...
asked 4 hours ago -
the
total pressure for a mixture of N2O4 and NO2 is 2.20 atm. If Kp=
7.10...
asked 4 hours ago -
Delaware Corp. prepared a master budget that included $22,385
for direct materials, $28,600 for direct labor,...
asked 4 hours ago -
For pesticide HCB (hexachlorobenzene), its logarithmic partition
coefficient log Kow is 5.6. What would be the...
asked 5 hours ago -
A chemist requires 0.422 mil Na2CO3 for a reaction. How many
grams does this correspond to?
asked 5 hours ago -
If the vapor pressure of carvone is approximately 9.4 torr at 99
°C, approximately how much...
asked 5 hours ago -
A juice bottling company is carrying out a test at 10%
significance that the mean population...
asked 5 hours ago -
What is the reflectivity (in percent) needed to keep water at a
temperature near its freezing...
asked 5 hours ago