Given the following base compositions, determine which double-stranded DNA molecule is expected to be the most thermodynamically stable?
■A + T = 10%
■A + T = 30%
■G + C = 60%
■G + C = 50%
G + C = 40%
Please explain!!
Thermostability of DNA :-
• When temperature is increased hydrogen bonds between nitrogen
bases of complementary DNA strands broken.
• DNA contains four bases- Guanine, Cytosine, Adenine, and Thymine.
Hydrogen bonds found between these bases.
• Double hydrogen bonds present between adenine and thymine while
triple hydrogen bonds present between cytosine and guanine.
• If there is more number of hydrogen bonds present in DNA, then
more heat will require for bond degradation and this DNA will be
more thermostable.
Now, which DNA has more hydrogen bonds.
• A DNA with more number of cytosine and guanine has more hydrogen
bonds (*because triple hydrogen bonds present between them which is
more then double bonds between adenine and thymine).
• So, A DNA strand with more Cytosine and guanine has higher
thermostability.
More G-C amount in DNA = More thermostable.
Now in question,
(A+T) + (G+C) = 100%
GC amount in DNAs -
(a) A+T = 10% so G+C = 100-10 = 90%
(b) A+T = 30% so G+C = 70%.
(c) G+C = 60%.
(d) G+C = 50%
(e) G+C = 40%.
Option (a) is most thermostable because highest amount of
G+C.
Thermostability order -
a>b>c>d>e
Given the following base compositions, determine which double-stranded DNA molecule is expected to be the most...
5) (3 pts) For a double-stranded DNA molecule, which of the following statements are true? If false, explain why. a. [A+C] = [G+T] b. [A+G] = [C+T) c. A=G and C=T d. A/T=C/G e. [A+T] = [G+C] f. C/A=T/G 6) (3 pts) Listed below are the base compositions of three different duplex DNA molecules. L S'ATTCTAACTTTGAT 3' 3' TAAGATTGAAACTA 5 IL S'CGCACTGGCTAACC 3' 3'GCGTGACCGATTGG 5' II. 5'CGCATTATTGTCAA 3' 3'GCGTAATAACAGTT 5' a) Order these three molecules in terms of their melting...
1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a. If the DNA contains 28% adenosine residues, how many guanosine residues are in the DNA? b. Are the nucleotide compositions of each of the two individual strands of DNA identical? Explain. c. If the DNA is entirely in the B-DNA conformation: i. How many helical turns does the DNA contain? ii. What is the length of the DNA? 2. Write the sequence of a...
DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...
A double-stranded DNA molecule of 175 base pairs long had (A+T/(G+C) = 0.75. How many adenine nucleotides are there in this DNA? 75 37.5 150
Which of the statement is true? If a double-stranded DNA molecule of 125 million base pairs were scaled to the size of a human hair, it would have a diameter of 0.003 inches and be 1 mile long. If this scaled-up DNA molecule were condensed and compacted into a chromosome, into which of the objects below could that chromosome fit? A. a tennis ball B. a bathtub C. a pencil eraser D. a soda (pop) can E. a basketball
For the following single-stranded DNA molecule: 3’ – G T A C A A G T C A – 5’ 1. Write the complementary strand, being sure to label polarity. (2 pts) 2. What is the GC content for the resulting double-stranded DNA molecule? (2 pts)
This figure represents supercoiled, circular, double-stranded DNA: If this molecule of DNA originated as a linear molecule with a linking number (L) of 30, which was then circularized and unwound, the L for the unwound circular molecule would be O32 O 18 O 28 O 30 20
1. Very simple toy model for base-pairing of double stranded DNA. (This problem is originally due to Kittel.) DNA is an important biological heteropolymer. A single DNA molecule base-pairs with a complementary DNA molecule to form a duplex double stranded structure. Consider two strands of complementary DNA. Each strand has N monomers. Each monomer is cross- linked by base-pairing to the corresponding monomer on the complementary DNA molecule. Suppose that the energy for breaking a cross link is є and...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
Suppose one strand of a DNA molecule contains the following proportions of nucleotides: 10% T, 20% A, 30% C, and 40% G. What proportions of the four types of nucleotides would you expect in the double-stranded form of this DNA molecule?