Suppose one strand of a DNA molecule contains the following proportions of nucleotides: 10% T, 20%...
DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...
For the following single-stranded DNA molecule: 3’ – G T A C A A G T C A – 5’ 1. Write the complementary strand, being sure to label polarity. (2 pts) 2. What is the GC content for the resulting double-stranded DNA molecule? (2 pts)
In the diagram below, you are provided with a known sequence of
DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL
LETTERS (e.g., GGCGGT), and work your way from the top to the
bottom.
A) Fill in the complementary DNA bases for DNA Strand 2 to form a
complete double-stranded DNA molecule.
B) Create an mRNA strand that is complementary to DNA Strand
1.
C) Using the mRNA sequence that you just created, determine the
complementary...
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10 The form of genetic recombination that allows movement of genetic elements from one DNA site to another is termed: O A site-specific recombination O B. homologous recombination ° C. branch migration D.transposition
QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
48) If one strand of a DNA double helix ha one strand of a DNA double helix has the sequence AGTACTG, what will be the sequence of the other strand? A) GACGTCA B) AGTACTGC) GTCATGAD) TCATGAC 49) A DNA molecule has the sequence AGTTCAACT. The equivalent RNA molecule would have the sequence AGTTCAACT B) AGUUCAACU C) UGTTCUUCT D) UGUUCUUCU 50) what group(s) in amino acid carboxyl and Amino D) Hydroxyl and Carboxyl B) carbonyl and Amino C) Hydroxyl and Carbonyl
Given the following base compositions, determine which double-stranded DNA molecule is expected to be the most thermodynamically stable? ■A + T = 10% ■A + T = 30% ■G + C = 60% ■G + C = 50% G + C = 40% Please explain!!
A double-stranded DNA molecule of 175 base pairs long had (A+T/(G+C) = 0.75. How many adenine nucleotides are there in this DNA? 75 37.5 150
DNA is a double-stranded molecule where two polynucleotide strands run antiparallel to each other, and the bases on one strand are complementary to the bases on the opposite strand. If one strand of a DNA molecule has the following sequence of bases, what would the sequence be for the complementary, antiparallel DNA strand? 3' GCTGATCAGGAC 5'
Because of Erwin Chargaff's experiments on the proportion of DNA nucleotides, what percentage of a DNA molecule would be adenine if you had 30% cytosine? Group of answer choices A. 20% B. 40% C. 30% D. 10% 2. Which of the following terms describes all of the genetic material of an organism? Group of answer choices A. Genome B. Chromosome C. Gene D. Translation