According to methods of sequencing a polypeptide, which one do you think more accurate in determining the composition and location of amino acids within a polypeptide chain. You should support your answer with a reason why you chose it over the other two methods.
There are two major direct methods of polypeptide sequencing:--
1.Mass Spectrometry.
2.Edman degradation using a protein sequencer.
Among these two the more accurate method is Mass Spectrometry because in this method we can sequence the point in the polypeptide which is of our interest while in the Edman degradation method we have to sequence all the amino acids from any one side of the polypeptide.
According to methods of sequencing a polypeptide, which one do you think more accurate in determining...
Which method do you think would be the most accurate in determining original concentration of cells in a culture? Why do you think that one is the most accurate method? plate count method? standard curve?
you will discuss methods used to control vector-borne and zoonotic diseases. 1) Is there one method you think is more beneficial than others? Why/why not? 2) Also, how large do you think is the impact of human environmental change on emerging infectious diseases in animals and man? Support your views.
What are the differences between projective and non-projective tests? Which do you think are more accurate and why?
Augu Q46. Below is a DNA sequence from a yeast GPCR gene. Using RNA sequencing methods you have obtained the following partial 5' sequence for the MRNA transcribed from this gene: 5'-GGUCCAU... 5'GTATAAGAAGCACTCTACCTCAATGGGTCCATGGGAGAAGGTAGGCATGTGTATTTGACAAAGGGA i. What are the most likely six N-terminal amino acids for the above gene? (2 pts) Examine the other reading frames. Explain why you can exclude those other possible reading frames from consideration (one or two reasons depending upon the frame). (2 pts) Circle the portion of...
question 37 and 38 please 36. Which one do you think would be more harmful. A mutation that changed the nucleotide sequence of an mRNA molecule, or a mutation that changed the nucleotide sequence of a DNA molecule? 5 points 37. All body cells have the same DNA complement yet all body cells do NOT contain the same proteins. How is this possible? 5 points 38. Consider a bacterial gene that is approximately 2100 nucleotides long. 3 Points Approximately how...
There are three elements which make up the drug use experience. Do you think any one of these elements has more influence, or is more important, than the other two? If so, which element and why? If not, why not?
Which method (Variable or Absorption) do you think provides the most accurate net income? Please include a discussion of the differences between the two costing methods as a part of your explanation. Please be sure to validate your opinions and ideas with citations and references in APA format.
Answer below in 5 sentences or more. Do you think too much or too little emphasis is placed on human relations within the work environment? What direction do you think should be taken in the future relative to emphasis on human relations? Why?
Why do you think the outer planets are larger and more gaseous than the inner planets? Is this typical of other solar systems that are being discovered by the Kepler Telescope? Give some examples to support your answer.
(2) When we discuss body composition results with an individual, why do you think that we as health professionals should carefully choose our words and try to soften what otherwise may be a harsh reality of poor results? Keep in mind, that even though we will be particular with what we say, that doesn't mean we don't report results or just simply glaze over them to make the individual feel better. (3) Body composition is a very broad term as...