Transcribe this DNA strand into mRNA and then translate it based
on the genetic code below using the single letter amino acid
abbreviation.
3'TATAAATGCTCTACAGTTACTAAAATCTTATTTGAC5'
The mRNA strand for the given DNA strand is given below:
DNA STRAND: TATAAATGCTCTACAGTTACTAAAATCTTATTTGAC
mRNA Strand: AUAUUUACGAGAUGUCAAUGAUUUUAGAAUAAACUG
Genetic code: AUA UUU ACG AGA UGU CAA UGA UUU UAG AAU AAA CUG
Amino Acid Sequence: Ile - Phe - Thr - Arg - Cys - Gln - Sec - Phe - Pyl - Asn -Lys - Leu
Amino Acid abbreviation: I - F - T - R - C - Q - U - F - O - N - K - L
The mRNA strand will be always complimentary to DNA strand. Replace the C with G, G with C, A with U and T with A.
Transcribe this DNA strand into mRNA and then translate it based on the genetic code below...
Starting with this strand of DNA: 1) transcribe it into mRNA, 2) translate the mRNA into its corresponding protein (USING SINGLE LETTER ABBREVIATIONS of the amino acids), and 3) determine the protein sequence if you had a DELETION mutation of the emboldened thymine. 3’ 5’ TCGGCGTGTACTACTACACGGTATATACGTTTCTTTTGATTAGCCGCTT
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate the mRNA. 5' GCGATGAAACGCCCGACGTAGGGC 3' 3' CGCTACTTTGCGGGCTGCATCCCG 5'
Transcribe the DNA sequence below: translate the mRNA sequence below:
Please replicate the gene. Then transcribe and translate the sister strand of DNA. Remember to label your molecules with the amino and carboxyl groups or the 3' and 5* as needed. 3'-A ATTAGCGATATGTACGCTACCGTACGATTAA-5| Secondliste Tynne UNA Stop codon UAC Stop codon UC Stop codon Third letter Methionines startonden
DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your LN) to translate the following mRNA sequences into amino acid sequences and answer the questions. mRNA nucleotide sequence (mRNA1) AUGGCAGACAAUAUUAAGUGA 1. What is the amino acid sequence? Mutation in the mRNA nucleotide sequence (mRNA2) AUGGCAGACCAUAUUAAGUGA 2. What is the new amino acid sequence? 3. How many bases were changed in mRNA2 compared to mRNA1? 4. What type of mutation was this? 5. How many...
a) Transcribe and translate this sequence of DNA (write the mRNA sequence and protein code) TACATGCCG TTTCAG GGG TTAGGC GCGAAATGCATC mRNA: Protein: b) What happens if I insert an "A" at the 9* nucleotide position in the original sequence given? What is the protein message now? modified DNA: mRNA: Protein: c) Which enzyme was used during transcription? What is the machinery/organelle responsible for building the protein? I
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
One strand of a section of DNA isolated from E. coli reads: Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be? What is the amino acid sequence of the proteins? Would the same proteins be made if the other strand of DNA served as template for transcription? Why or why not? If the T underlined in the above sequence was to go...