How will you determine the transcription factor binding sites in the whole genome? Give at least one example from literature.
ChiP-ChiP or ChiP Sequencing are methods that can be used to detect transcription factor binding sites on the genome. They are based on Chromatin immunoprecipitation, that can detect the DNA protein interactions. This technique captures proteins at the site of its interaction with DNA. The DNA is extracted and then fixed with formaldehyde. Formaldehyde cross links the DNA with protein, so that the transcription factor remains bound to the nucleus. The DNA protein complexes are sonicated to fragments that are 200-1000 bp in length. These fragments are immunoprecipitated using specific antibodies to the transcription factor. The DNA protein crosslinks are reversed and then the DNA sequence is obtained. The expression of genes regulated by this transcription factor can then be identified by PCR analysis.
Whole genome ChiP sequencing will sequence numerous DNA fragment simultaneously. It is more specific than ChiP-ChiP tiling arrays as it involves direct sequencing. ChiP sequencing has been used to detect transcription factor binding sites of many transcription factor. It has been used to detect transcription factor binding sites for genes: ZIC2, OTX2, SOX2, POU5F1 and POU3F1 (all stem cell related genes) in epiblast stem cells. Microfluidic platforms can be used to identify transcription factors binding sites of several transcription factors simultaneously for a genome. Genomic libraries are prepared from the DNA fragments identified by the Chip, which are then used for sequencing.
As per Chegg’s rules, no references can be attached.
How will you determine the transcription factor binding sites in the whole genome? Give at least...
The hunchback gene has an enhancer containing 3 binding sites for the transcription factor Bicoid. How could the loss of a single DNA binding site -leaving the 2 others intact- act to reduce gene expression of hunchback by more than 1/3 ? A. Bound Bicoid transcription factor molecules interact antagonistically to cause maximal gene expression B. Bound Bicoid transcription factor molecules interact additively to cause maximal gene expression C. Bicoid does not bind to the hunchback enhancer D. Bound Bicoid...
1) You have transfected siRNA against transcription factor A into cells that normally express the transcription factor. These cells also contain a luciferase reporter gene that is controlled an enhancer that has multiple binding sites for transcription factor A. a. What would be the effect on reporter gene activity b. How could you determine whether RNAi acts at the level of mRNA or translation in this case?
6. The gene for a hormone necessary for insect development contains binding sites for three transcription regulators called A, B, and C. Because the binding sites for A and B overlap, A and B cannot bind simultaneously. You make mutations in the binding sites for each of the proteins and measure hormone production in cells that contain equal amounts of the A, B, and C proteins. Figure 08-65 summarizes your results. For each of the following sentences, indicate if the...
1.) Transcription a.) Every non-general transcription factor (e.g. CREB1) needs at least two functional domains to initiate transcription. Name and describe the function of these two domains. (15 words per domain)(10 points) b.) How is chromatin around active promoters different from a transcriptionally inactive areas of the genome? (30 words) (10 points) c.) TFIIH is a general transcription factor with Helicase and Kinase activity. Describe how these two activities assist RNA Pol II with transcription initiation? (30 words) (10 points)
. If we increase the concentration of NaCl how will change the binding of our transcription factor to the DNA? How will change the melting point of DNA? Of course, explain.
Certain laboratories often need to prepare DNA duplexes for transcription factor binding assays. The DNA is purchased as single-stranded polynucleotides and hybridize them to form our duplexes, but this almost always leaves behind some un-renatured, single-stranded DNA, in the solution. How would you go about removing the single-stranded DNA fromour duplexes?
This double-stranded DNA represent a typical prokaryotic promoter containing both binding sites for sigma factor 70. The start codon, ATG, is shown at the end of the promoter. Determine the sequence of the transcribed product from this promoter (up until and including the start codon). 5' CATGCTATAATGCTGTATTGAGATTATATTGACACTCAATAGGTTGTCAAGTGATG 3' 3' GTACGATATTACGACATAACTCTAATATAACTGTGAGTTATTCAACAGTTCACTAC 5
You are using a ChIP assay to study the positioning of a
DNA-binding transcription factor
(Dbp1p) on transcribed genes. You fragment DNA from wild type
cells and immunoprecipitate
Dbp1p with an antibody to it. Then you PCR amplify the DNA
associated with Dbp1p using
different sets of primers for a particular gene (G3PD). One set
of primers was specific for the
TATA box region of this gene, (lane 1) another pair of primers
amplified the 3’ end of the open...
1.Explain case-control and cohort study designs? How do the two designs differ? Give at least one example from the text or the literature. 2. Define validity and reliability using examples.
What is meant by a “binding price floor?” Give an example and explain how a binding price floor affects the market equilibrium.