Homework Answers
The ATG sequence after the TATA sequence is the site from where the transcription starts. Hence the transcribed product is:
5' - AUGCUGUAUUGAGAUUAUAUUGACACUCAAUAGGUUGUCAAGUGAUC -3'
This will be the transcribed product where the coding strand's T will be converted to U.
If you have any query kindly comment before giving thumbs up. Thank you.
Add Answer to:
This double-stranded DNA represent a typical prokaryotic promoter containing both binding sites for sigma factor 70....
A segment of a double-stranded DNA molecule is shown below. The start of a gene is...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5...
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...
Draw a typical prokaryotic gene with its promoter and terminator. Draw the primary transcript Label (using...
Draw a typical prokaryotic gene with its promoter and terminator. Draw the primary transcript Label (using letters) all the parts (including sites of consensus sequences) in both the gene and the mRNA. Indicate what the ‘letters stand for. (Use the line drawing below). What proteins are involved in transcription initiation, elongation and termination in prokaryotic genes. +1 5’ ________________________________________________________________ 3’ 3’ ________________________________________________________________ 5’
Below is the partial coding strand of DNA for a gene containing an ORF, shown 5'...
Below is the partial coding strand of DNA for a gene containing
an ORF, shown 5' to 3'. Identify the regions, shown 1 to 9,
associated with the following genetic elements. Some elements may
have more than one associated region.
(a) The promoter region
(b) The ribosome binding site
(c) The ribosome binding site consensus
sequence
(d) The start codon
(f) The expected region for the +1
transcription (where the transcript
begins to be made)
(g) Is this a prokaryotic...
6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures...
6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures and tutorial manual and listed below. Prokaryotis operon promoter (-10 and -35 elements), operator, multiple structural renes (for example 3), start site of transcription, start sites of translations, transcription termination sequence Prokaryotic mRNA (polycistronie): transcription start site, multiple ribosome binding sites The Shine-Dalgamo sequence in Ecoli), multiple ORFs (including start and stop codons). transcription termination sequence Eukaryotic genes promoter (TATA box), consensus sequence CAAT,...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...
The following is a fragment of double stranded DNA . The bottom strand is the template...
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
hi please help. im having trouble with transcribing the given dna fragment! 1. A double stranded...
hi please help. im having trouble with transcribing the given
dna fragment!
1. A double stranded DNA has the following sequence: +1 5' GGCGGCGGCTGCCTATGCTGGCTTCAGCGTAGGCGTAC 3' coding strand TIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 3' CCGCCGCCGACGGATACGACCGAAGTCGCATCCGCATG 5' A UUU UAUTY ser UCO Stog Transcribe the given DNA fragment (5-GGC GGA UGC CUC GGC UGG CUU AAG CGG AC 5'UTR (highlight in green) Second Letter с 3' UTR (highlight in blue Start Codon (highlight in yellow) VUC ) Stop Codon (highlight in red) Open reading frame (enter...
1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a....
1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a. If the DNA contains 28% adenosine residues, how many guanosine residues are in the DNA? b. Are the nucleotide compositions of each of the two individual strands of DNA identical? Explain. c. If the DNA is entirely in the B-DNA conformation: i. How many helical turns does the DNA contain? ii. What is the length of the DNA? 2. Write the sequence of a...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...
Below is the partial coding strand of DNA for a gene containing
an ORF, shown 5' to 3'. Identify the regions, shown 1 to 9,
associated with the following genetic elements. Some elements may
have more than one associated region.
(a) The promoter region
(b) The ribosome binding site
(c) The ribosome binding site consensus
sequence
(d) The start codon
(f) The expected region for the +1
transcription (where the transcript
begins to be made)
(g) Is this a prokaryotic...
6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures and tutorial manual and listed below. Prokaryotis operon promoter (-10 and -35 elements), operator, multiple structural renes (for example 3), start site of transcription, start sites of translations, transcription termination sequence Prokaryotic mRNA (polycistronie): transcription start site, multiple ribosome binding sites The Shine-Dalgamo sequence in Ecoli), multiple ORFs (including start and stop codons). transcription termination sequence Eukaryotic genes promoter (TATA box), consensus sequence CAAT,...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
hi please help. im having trouble with transcribing the given
dna fragment!
1. A double stranded DNA has the following sequence: +1 5' GGCGGCGGCTGCCTATGCTGGCTTCAGCGTAGGCGTAC 3' coding strand TIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 3' CCGCCGCCGACGGATACGACCGAAGTCGCATCCGCATG 5' A UUU UAUTY ser UCO Stog Transcribe the given DNA fragment (5-GGC GGA UGC CUC GGC UGG CUU AAG CGG AC 5'UTR (highlight in green) Second Letter с 3' UTR (highlight in blue Start Codon (highlight in yellow) VUC ) Stop Codon (highlight in red) Open reading frame (enter...
1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a. If the DNA contains 28% adenosine residues, how many guanosine residues are in the DNA? b. Are the nucleotide compositions of each of the two individual strands of DNA identical? Explain. c. If the DNA is entirely in the B-DNA conformation: i. How many helical turns does the DNA contain? ii. What is the length of the DNA? 2. Write the sequence of a...
Most questions answered within 3 hours.
-
How much 0.1200 M sodium hydroxide solution is need to titrate
14 mL of a 0.100...
asked 3 minutes ago -
1a)When a 5000-kg roller coaster train full of riders approaches
the loading dock at a speed...
asked 27 minutes ago -
The Poseidon Swim Company produces swim trunks. The average
selling price for one of their swim...
asked 23 minutes ago -
If the elasticity of supply of a good is ∞, then its
A. supply curve is...
asked 9 minutes ago -
An impulse is a change in momentum usually over
a short time. For which of the...
asked 7 minutes ago -
Write an application for the Shady Rest Hotel; the program
determines the price of a room....
asked 13 minutes ago -
USE THE FOLLOWING INFORMATION TO ANSWER THE NEXT (6)
QUESTIONS:
The following is a December 31,...
asked 29 minutes ago -
Suppose you plan to invest $5,000 each year (beginning at the
end of this year) into...
asked 20 minutes ago -
What is the cell potential of the following cell at 25
oC? Note Au is a...
asked 21 minutes ago -
DNA to Protein
Describe the mutation that created the HbS allele:
type of mutation, location of...
asked 26 minutes ago -
Which attribute allows you to specify a custom "thumbnail" for
multimedia elements?
asked 27 minutes ago -
1. Why are the advantages and disadvantages of object-oriented
databases? 2. What are data marts? How...
asked 46 minutes ago