ACG- threonine-ACC
GUU- valine- GUA
UUC- phenylalanine- UUU
CAC- Histidine- CAU
GGA- glycine- GGG
For each codon, match a second codon that would result in the addition of the EXACT...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...
EXERCISE Translation What two amino acids have only one codon? Enter their 3 letter abbreviations 2nd Mueles de Phe UUU UUC UUA UU Cys ucu UCC UCA UCO UGU UGC UAU UAC WA UA Stop dodon Stop codoh UOO Stop dod TEP CGU Ang CUU CUC CUA CU не His Oin Ag CAU CAC CAA CAC 3 15 Nuolatida COA COG din AUU AUC AUA AUG Initiation Codon ACU ACC ACA Асе UGAGUC6UcAGUCA Nucleotide AAC AAA AAO AGU AOC AGA...
1. The following nucleotide sequence is found on a strand of mRNA. Give the altered amino acid sequence of the protein that will be found in each of the following mutations. Please also list an anticipated phenotypical change(s) (nonsense, missense, frameshift, addition/subtraction of amino acid etc.) (1 pts each) Second position Nucleotide #: 1 4 7 10 13 U UUU 16 19 22 UCU UAU UGU UUC UAC UAA UUA UUD RNA: 5-AUG ACC GGC AAU CAA CUA UAU UGA-3'...
all of them please
Question 12 (1 point) Which of the following conditions would kill amp' lac his bacteria? amp = ampicillin (an antibiotic), lac = lactose (a carbohydrate), his = histidine (an amino acid) A) growing the bacteria in media that contained ampicillin, had lactose as the sole metabolic carbon source, and contained the amino acid histidine. B) growing the bacteria in media that contained ampicillin, had lactose as the sole metabolic carbon source, but did not contain the...
If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...
5' or or Using the codon table provided, fill in the missing entries in the following table (yellow boxes with numbers). Assume that the reading frame is fromleft to right(and the start codon is not SHOWN here, but EXISTS upstream [to the left] of the sequence shown here) and that columns represent transcriptional and translational alignments. 5. Strand ID? 3' 1 3 4 5 6 A T G | I | G | 15 16 7. 14 17 དུ་ U...