Compare the activities of E. coli DNA polymerase III and RNA polymerase by describing the following properties of each:
DNAP III (Replication) |
RNAP (Transcription) |
|
Substrate(s) i.e. what does the enzyme link together |
||
Name for the site of enzyme binding |
||
Is a primer required? What serves as template(s)? |
||
End product |
||
Direction of polymerization |
The complete table is as follows :-
DNAP III (Replication | RNAP (Transcription) | |
Substrate(s) i.e. what does the enzyme link together | This enzyme links together deoxyribonucleotides. | This enzyme links together ribonucleotides. |
Name for the site of enzyme binding | DNA polymerase III binds to the primer and adds nucleotides to the 3' end of the primer using the parent strand as the template. | RNA polymerase binds to regions of DNA called promoter, which are “start” signals for transcription |
Is a primer required? What serves as template(s)? |
Yes, a primer is required. Each strand of DNA serves as a template for the synthesis of a new complementary strand. |
No, primer is not required. The antisense strand of DNA serves as the template for RNA transcription. |
End product | The end product is always DNA. | The end product is always mRNA. |
Direction of polymerisation |
The polymerisation happens in the 5' to 3' direction. |
The polymerisation happens in the 5' to 3' direction. |
Compare the activities of E. coli DNA polymerase III and RNA polymerase by describing the following...
Match the following (Total 24 pts) Enzyme responsible for joining DNA strands together The nascent DNA strand that is being synthesized in the same direction as the replication fork. Enz 39 DNA polymerase 40 DNA helicase responsible for transcribing RNA 41DNA sliding clamp 42 Single Stranded Binding Proteins DShort, newly synthesized DNA fragments 43 RNA primer 44 DNA ligase formed on the lagging template strand E Abundle or proteins that assist in the rate of transcription of DNA to mRNA....
Define termsDNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication, mutation, gene, amino acid, polypeptide chain, protein, codon, promoter region of a gene, RNA polymerase, transcription, mRNA, tRNA, RNA, ribosomes, translation, gene expression, conjugation, conjugative pilus, transformation, transductionExplain concept or process• Describe how nucleotides are linked together to form a single strand of nucleic acid• Explain the concept of a complementary pairing • Describe how DNA replication occurs in bacteria • Explain why a primer is necessary for...
1a.) Which of the following characteristics is not associated with E. coli primase? A.) it synthesizes the RNA primer in DNA replication B.) it synthesizes a primer with a free 3'−OH end C.) it is essential for DNA replication D.) it is essential for RNA replication 1b.) Which of the following is not required for optimal DNA replication? A.) Gyrase B.) Primase C.) Single strand binding proteins. D.) All of these are necessary. E.) DNA Polymerase II.
In rho-dependent transcription termination: the formation of a hairpin in the transcribed mRNA causes RNA polymerase to pause, facilitating termination. rho binds the mRNA, and when it makes contact with RNA polymerase, it assists with the removal of the mRNA from the DNA template. the rho factor binds to the -10 consensus sequence located in the promoter region to terminate transcription. a site within the poly(A) tail is cleaved which signals termination. the 3' untranslated region (3" UTR) is synthesized....
BioLoG 11. chose the order below that most closely represents the order in which the following proteins participate in DNA replication. a. helicase, single stranded binging protein, primase DNA polymerase b. single -stranded binding protein, primase DNA polymerase helicase c. primase, DNA polymerase, single- stranded binding protein, helicase d. helicase, single- stranded binding protein DNA polymerase, primase. 12. what is the function of the enzyme primase during DNA replication? a. to unwind the double helix to prime it for replication...
What DNA/RNA/protein(s) is/are involved in the following processes in... DNA Replication Transcription - Prokaryotes Transcription - Eukaryotes What serves as the template? Unwinding of DNA Initiation Elongation What direction does elongation occur? Termination What is the end product of this process? How many strands? Processing after?
29. The initiator RNA attaches at the ribosome's site. A. A B. translocon C. E DP E. O 30. Which one of the following, if missing, would usually prevent translation from starting? A. one of several exons in a mRNA B. poly-A tail C. AUG codon D. spliceosome E. RNA polymerase 31. Which of the following statements about DNA synthesis is true? A. Nucleotides are added in a random fashion to single-stranded DNA. B. DNA polymerase adds dNTP monomers in...
1) Which of the following is FALSE about RNA polymerase?It does NOT require a primer to begin synthesis It synthesizes RNA 5’ to 3’ It catalyzes the formation of phosphodiester bonds It only transcribes one of the two DNA strands for any particular gene It only transcribes exons 2)Which of the following is not synthesized from, or does not use DNA as a template? Introns Poly A tail Ribosomal binding site Primase RNA polymerase 3) Which of the following is...
please explain a and b shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as...
Vocabulary: DNA Replication A. Helicase B. Primase C. Single Strand Binding Protein (SSB) D. Topoisomerase E. Origin of Replication F. DNA Polymerase G. Leading Strand H. Lagging strand I. DNA Ligase J. Okazaki Fragment K. Replication Fork L. RNA Primer M. Topoisomerase .1. Site where the replication of a DNA molecule begins. 2. The new continuous complementary DNA strand synthesized in the direction for the replication fork. 3. A discontinuously synthesized DNA strand that elongates in a direction away from the replication fork 4. Relaxes...