1.How does the genetic code in the DNA get passed on to the mRNA?
the genetic code in DNA is get transcripted into m RNA using process called transcription by using enzyme RNA polymerase and nucleotides complimentary to DNA template stand.
Transcribe this DNA strand into mRNA and then translate it based on the genetic code below using the single letter amino acid abbreviation. 3'TATAAATGCTCTACAGTTACTAAAATCTTATTTGAC5'
Genetic Code The genetic code is what allows the string of nucleotides in our DNA to code for the sequence of amino acids that make up proteins. Briefly explain what this genetic code is in general and how it works. What is meant by the universality of the genetic code? Explain briefly what the advantages and disadvantages of this type of genetic code are to humans. ANSWER MUST BE ORIGINAL AND NO PLAGIARISM
DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your LN) to translate the following mRNA sequences into amino acid sequences and answer the questions. mRNA nucleotide sequence (mRNA1) AUGGCAGACAAUAUUAAGUGA 1. What is the amino acid sequence? Mutation in the mRNA nucleotide sequence (mRNA2) AUGGCAGACCAUAUUAAGUGA 2. What is the new amino acid sequence? 3. How many bases were changed in mRNA2 compared to mRNA1? 4. What type of mutation was this? 5. How many...
In the process of translation, mRNA attaches to ribosomes DNA is replicated proteins are synthesized RNA is synthesized QUESTION 11 What does it mean when we say the genetic code is unambiguous? More than one codon can specify the addition of the same amino acid. The genetic code is different for different domains of organisms. Each codon can specify the addition of only one amino acid. The genetic code is universal (the same for all organisms).
DNA Technology What is biotechnology? • What is genetic engineering? How does it relate to recombinant DNA? • What are genetically modified organisms (GMOs)? • What are transgenic organisms? • What are some controversies surrounding GMOs? • What do the world’s leading health agencies think about GMOs? • What are some benefits of GMOs? • How does gene therapy work? • Describe the basic steps of making recombinant DNA. • What are the two major products that you get after...
1. Explain the antiparallel DNA structure. (5 points) 2. How does a DNA molecule code for a protein. Describe the process completely. (10 points) 3. How does DNA replication ensure accuracy. (5 points)
using the codon table, write mRNA and DNA (double stranded) sequence for the peptide below (assume a stop codon is present and include it). Several correct sequences are possible due to the degeneracy of the genetic code; write only one sequence for each question. Remember to properly label ends. H2N - Methionine - Aspartate - Lysine - Serine - Valine - Leucine - COOH mRNA: DNA:
3. The mRNA base sequence below codes for part of a protein. Using the genetic code table in your text (p. 731 or the inside back cover), determine the amino acid sequence encoded by this piece of mRNA. (13 pts) mRNA: CAU GAA CU ACCUA GUGCU GUUGAA AU CAC CGCGCUCCU A protein:
a) Transcribe and translate this sequence of DNA (write the mRNA sequence and protein code) TACATGCCG TTTCAG GGG TTAGGC GCGAAATGCATC mRNA: Protein: b) What happens if I insert an "A" at the 9* nucleotide position in the original sequence given? What is the protein message now? modified DNA: mRNA: Protein: c) Which enzyme was used during transcription? What is the machinery/organelle responsible for building the protein? I
The DNA code for a hypothetical gene is: TAC TTG GGT CCT What is the mRNA sequence?