3. If an mRNA has 4 exons, how many different combinations of exons could be made...
3. If an mRNA has 4 exons, how many different combinations of exons could be made if EXON 1 must be kept?
b. How many different proteins could be made from the information above?
Homework Answers
3. 1,2,3,4
If 1 is kept and one exon is removed at a time then 2 combinations of exons could form-
1,3,4
1,2,3
b. two different proteins could be formed from these two combinations.
Add Answer to:
3. If an mRNA has 4 exons, how many different combinations of
exons could be made...
A geneticist discovers that two different proteins are encoded by the same gene. One protein has...
A geneticist discovers that two different proteins are encoded by the same gene. One protein has 56 amino acids, and the other has 82 amino acids. Which of the statements are possible explanations for how the same gene can encode both of these proteins? 1-The same gene encodes both proteins by using different combinations of introns in the pre‑mRNA via alternative splicing. 2-The same gene encodes both proteins by generating a poly(A) tail on the pre‑mRNA. 3-The same gene encodes...
The following mRNA sequence is taken from the middle of exon 3 in a mature mRNA...
The following mRNA sequence is taken from the middle of
exon 3 in a mature mRNA that has many exons, and the mRNA encode 9
amino acids.
Question: Knowing that this mRNA does not have an early
stop codon, which of the reading frames shown is the correct one
for this mRNA? Write down 1, 2, or 3 as your answer. Explain
why?
5'..AGUGAUUCGAUACAGCUAGCGGACAGCUA...3 1 ... Reading frames: Z E hahaha ...hohohoh
OLU Ucues Assignment 4c. In eukaryotes, genes are composed of exons and introns, with only exons...
OLU Ucues Assignment 4c. In eukaryotes, genes are composed of exons and introns, with only exons included in the mRNA. Each gene also has its own adjacent promoter, to which the transcribing enzyme RNA polymerase binds. Related genes may be clustered together on the same chromosome as a “gene family." Answer each of the following questions in the answer box of the assignment. You may also write the answers directly into the assignment document and then upload your answers. Number...
A eukaryotic protein-encoding gene has three introns and 4 exons. A splicing repressor commonly binds to...
A eukaryotic protein-encoding gene has three introns and 4 exons. A splicing repressor commonly binds to the 3' end of the second intron (introns 2/ exon three splice sites) draw the mRNA strand before and after splicing Diagram a final functional eukaryotic mRNA molecule from the 5' end to 3' end. There should be 7 items labeled in the diagram.
Question 12 (1 point) How many different allele combinations can be made if the genotype of...
Question 12 (1 point) How many different allele combinations can be made if the genotype of the parent is AaBB? 1 3 6
Can someone please help with these two questions? Thank you. 4. Here is an RNA transcript...
Can someone please help with these two questions? Thank you.
4. Here is an RNA transcript freshly transcribed from a gene. It is immature, meaning that it has not been processed yet into a mature mRNA. a) If you could zoom in on this molecule, what two things would you observe at the molecular level that would indicate to you that it is RNA and not DNA? b) Which end of the molecule was the last bit to be transcribed,...
QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated...
QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated in the gene map below. The 5' UTR and 3' UTR segments are each 25 bp long. Exons 1 thru 4 are 100, 200, 300, 400 bp long, respectively. Each intron is 200 bp each. The locations of the relevant EcoRI sites within the ACEX locus are indicated, but the location of other restriction enzyme sites (like BamHI) are not shown." EcoRI probe EcoRI...
000_ U SEJJIBU contentId-_876188.1&step Question Completion Status: QUESTION 1 In eukaryotic genes, a. coding exons are...
000_ U SEJJIBU contentId-_876188.1&step Question Completion Status: QUESTION 1 In eukaryotic genes, a. coding exons are separated by noncoding introns b. coding introns are separated by noncoding exons c. all genes consist of an uninterrupted coding sequence d.genes can include the coding sequences for multiple proteins e. both (c) and (d) QUESTION 2 A gene with 8 exons would have ___ introns. b.9 0.8 d. 24 e. 16 QUESTION 3 The gene for rhodopsin has 5 exons and 6706 nucleotides....
CACTATGCCGGTAAGGTTCCCATGACC 1. If the above sequence was the coding strand, what mRNA would be made from...
CACTATGCCGGTAAGGTTCCCATGACC 1. If the above sequence was the coding strand, what mRNA would be made from it? 2. How many reading frames are in that mRNA? 3. How many open reading frames are in that mRNA and what is it/are they? 4. Translate the open reading frame(s).
3of 3 9. The figure below represents the primary transcript of a gene that contains four exons (A, B, C, D) and two introns. The dark block in exon B indicates the position of an additional stop...
3of 3 9. The figure below represents the primary transcript of a gene that contains four exons (A, B, C, D) and two introns. The dark block in exon B indicates the position of an additional stop codon; the normal start and stop codons for translation are present in exons A and D respectively. The two arrows indicate alternative 3' splice sites for the first intron Pre-mRNA 5'I 3' intron intron Give a schematic representation of the mature mRNAs that...
The following mRNA sequence is taken from the middle of
exon 3 in a mature mRNA that has many exons, and the mRNA encode 9
amino acids.
Question: Knowing that this mRNA does not have an early
stop codon, which of the reading frames shown is the correct one
for this mRNA? Write down 1, 2, or 3 as your answer. Explain
why?
5'..AGUGAUUCGAUACAGCUAGCGGACAGCUA...3 1 ... Reading frames: Z E hahaha ...hohohoh
OLU Ucues Assignment 4c. In eukaryotes, genes are composed of exons and introns, with only exons included in the mRNA. Each gene also has its own adjacent promoter, to which the transcribing enzyme RNA polymerase binds. Related genes may be clustered together on the same chromosome as a “gene family." Answer each of the following questions in the answer box of the assignment. You may also write the answers directly into the assignment document and then upload your answers. Number...
Question 12 (1 point) How many different allele combinations can be made if the genotype of the parent is AaBB? 1 3 6
Can someone please help with these two questions? Thank you.
4. Here is an RNA transcript freshly transcribed from a gene. It is immature, meaning that it has not been processed yet into a mature mRNA. a) If you could zoom in on this molecule, what two things would you observe at the molecular level that would indicate to you that it is RNA and not DNA? b) Which end of the molecule was the last bit to be transcribed,...
QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated in the gene map below. The 5' UTR and 3' UTR segments are each 25 bp long. Exons 1 thru 4 are 100, 200, 300, 400 bp long, respectively. Each intron is 200 bp each. The locations of the relevant EcoRI sites within the ACEX locus are indicated, but the location of other restriction enzyme sites (like BamHI) are not shown." EcoRI probe EcoRI...
000_ U SEJJIBU contentId-_876188.1&step Question Completion Status: QUESTION 1 In eukaryotic genes, a. coding exons are separated by noncoding introns b. coding introns are separated by noncoding exons c. all genes consist of an uninterrupted coding sequence d.genes can include the coding sequences for multiple proteins e. both (c) and (d) QUESTION 2 A gene with 8 exons would have ___ introns. b.9 0.8 d. 24 e. 16 QUESTION 3 The gene for rhodopsin has 5 exons and 6706 nucleotides....
CACTATGCCGGTAAGGTTCCCATGACC 1. If the above sequence was the coding strand, what mRNA would be made from it? 2. How many reading frames are in that mRNA? 3. How many open reading frames are in that mRNA and what is it/are they? 4. Translate the open reading frame(s).
3of 3 9. The figure below represents the primary transcript of a gene that contains four exons (A, B, C, D) and two introns. The dark block in exon B indicates the position of an additional stop codon; the normal start and stop codons for translation are present in exons A and D respectively. The two arrows indicate alternative 3' splice sites for the first intron Pre-mRNA 5'I 3' intron intron Give a schematic representation of the mature mRNAs that...
Most questions answered within 3 hours.
-
While fishing you discover two types of mullet. Some
of the mullet jump out of the water...
asked 31 seconds ago -
PLEASE DO BOTH OF THESE IN PYTHON!!! AND MAKE SURE THAT
I CAN COPY THE CODE....
asked 3 minutes ago -
4. How could the Fed "finance the government's debt"? How does
that work, exactly?
5. In...
asked 7 minutes ago -
The x component of the velocity of an object vibrating
along the x-axis obeys the equation...
asked 1 hour ago -
A junction box contains two trade size 2 raceways on the left
side, and two trade...
asked 1 hour ago -
Atmospheric Mass
Venus and Earth have about the same mass and radius, but the
atmospheric pressure...
asked 2 hours ago -
5. Discuss the use of fault tree analysis (FTA) for risk
assessment (maximum one paragraph).
asked 3 hours ago -
Given that a sample of aluminium oxide has a Young's modulus of
393 GPa and a...
asked 5 hours ago -
At a certain temperature, the equilibrium constant, Kc, for this
reaction is 53.3.
H2(g)+I2(g)−⇀↽−2HI(g)Kc=53.3
At this...
asked 6 hours ago -
Question1 ) The STL provides similiar classes called stack and
queue, both of which gave functions...
asked 7 hours ago -
For Questions 1-4, assume you have 5 bits available:
1. For (positive) integers: What is the...
asked 7 hours ago -
convert grams into vloume with the density of water being at
.997514 g/cm^3 at 23.1 Celsuis...
asked 9 hours ago