is it possible for a change in one nucleotide of an organism’s DNA to result in...
Homework Answers
Yes, It is possible. If even one nucleotide gets change, it will change the codon and now thia codon will code for a different amino acid. This amino acid after getting incorporated in the protein sequence can alter the function of the protein and can result in a change in organism's biological system functioning.
Add Answer to:
is
it possible for a change in one nucleotide of an organism’s DNA to
result in...
4. (Sheldon Ross) A DNA nucleotide has any one of four values {A, G,C,T). A standard model for a mutational change of the nucleotide at a specific location on the DNA strand, is a Markov model that a...
4. (Sheldon Ross) A DNA nucleotide has any one of four values {A, G,C,T). A standard model for a mutational change of the nucleotide at a specific location on the DNA strand, is a Markov model that assumes that from one time step to the next, the probability that the nucleotide remains unchanged equals 1-3α, for some α, 0 < α < 1 . If it does change (i.e., the nucleotide undergoes mutation), then it can change to any of...
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C...
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)
32. Unknown DNA was analyzed and the result showed the nucleotide composition as follows: A T...
32. Unknown DNA was analyzed and the result showed the nucleotide composition as follows: A T C Composition % 21 21.5 38.5 What does the analysis reveal about DNA structure and why? (3 pt) 19 33. During chromatin remodeling DNA must be replicated as well as histone proteins. List (no explanation) the enzymes involved in chromatin remodeling (3 pt).
S result of various nucleotide conformations. Discuss (b) DNA is polymorphic in nature as a the...
S result of various nucleotide conformations. Discuss (b) DNA is polymorphic in nature as a the flexibility around the B-N-glycosidic bond and the sugar puckers.
A single nucleotide deletion in the DNA causes a protein change in sequence from Ser –...
A single nucleotide deletion in the DNA causes a protein change in sequence from Ser – Thr – Ile – Ser – Gly – Ala – Arg – Leu To Ser – Thr – Leu – Ala – Glu – Pro – Val What are the old and new mRNA nucleotide sequences?
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
What part(s) of a nucleotide will occupy the major & minor groove of a double-stranded DNA...
What part(s) of a nucleotide will occupy the major & minor groove of a double-stranded DNA molecule? WHY? What parts are found in the DNA backbone? WHY? Where would a Restriction Endonuclease associate with DNA? How long is a double-stranded DNA molecule that is 2 x 105 bp? How many nucleosomes would be required to package this DNA if it were in a Eukaryote? When chromatin from any eukaryote is digested briefly with micrococcal nuclease (an endonuclease) and fractionated using...
QUESTION 3 In a "frameshift" mutation O a the mutation is not in DNA. the nucleotide...
QUESTION 3 In a "frameshift" mutation O a the mutation is not in DNA. the nucleotide that mutates causes a stop codon to occur instead of the placement of an amino acid. c. addition or deletion of one or two nucleotides causes the codons to be off pattern and therefore the mutation. 4. the nucleotide that mutates causes no change in the amino acid specified.
What potential outcomes are possible after replication in a DNA molecule with a depurination modification that...
What potential outcomes are possible after replication in a DNA molecule with a depurination modification that is left unrepaired? Choose one or more: A.The DNA molecule contains the normal sequence. B.The DNA molecule contains an extra three nucleotide pairs. C.The DNA molecule is missing one nucleotide pair. D.The DNA molecule is converted into RNA.
A substitution mutation is one in which one nucleotide base is changed to another
2. A substitution mutation is one in which one nucleotide base is changed to another Suggest ONE substitution A G mutation in the DNA that would cause the first amino acid in the "# of Eyes" gene to change from alanine (Ala) to valine (Val). In the table below, write the original.3. There is a substitution mutation in the gene for Fangs in which the first DNA base changes from guanine to thymine. The mutation results in a genetic disorder...
4. (Sheldon Ross) A DNA nucleotide has any one of four values {A, G,C,T). A standard model for a mutational change of the nucleotide at a specific location on the DNA strand, is a Markov model that assumes that from one time step to the next, the probability that the nucleotide remains unchanged equals 1-3α, for some α, 0 < α < 1 . If it does change (i.e., the nucleotide undergoes mutation), then it can change to any of...
32. Unknown DNA was analyzed and the result showed the nucleotide composition as follows: A T C Composition % 21 21.5 38.5 What does the analysis reveal about DNA structure and why? (3 pt) 19 33. During chromatin remodeling DNA must be replicated as well as histone proteins. List (no explanation) the enzymes involved in chromatin remodeling (3 pt).
S result of various nucleotide conformations. Discuss (b) DNA is polymorphic in nature as a the flexibility around the B-N-glycosidic bond and the sugar puckers.
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
What part(s) of a nucleotide will occupy the major & minor groove of a double-stranded DNA molecule? WHY? What parts are found in the DNA backbone? WHY? Where would a Restriction Endonuclease associate with DNA? How long is a double-stranded DNA molecule that is 2 x 105 bp? How many nucleosomes would be required to package this DNA if it were in a Eukaryote? When chromatin from any eukaryote is digested briefly with micrococcal nuclease (an endonuclease) and fractionated using...
QUESTION 3 In a "frameshift" mutation O a the mutation is not in DNA. the nucleotide that mutates causes a stop codon to occur instead of the placement of an amino acid. c. addition or deletion of one or two nucleotides causes the codons to be off pattern and therefore the mutation. 4. the nucleotide that mutates causes no change in the amino acid specified.
Most questions answered within 3 hours.
-
Atmospheric Mass
Venus and Earth have about the same mass and radius, but the
atmospheric pressure...
asked 59 minutes ago -
5. Discuss the use of fault tree analysis (FTA) for risk
assessment (maximum one paragraph).
asked 2 hours ago -
Given that a sample of aluminium oxide has a Young's modulus of
393 GPa and a...
asked 3 hours ago -
At a certain temperature, the equilibrium constant, Kc, for this
reaction is 53.3.
H2(g)+I2(g)−⇀↽−2HI(g)Kc=53.3
At this...
asked 4 hours ago -
Question1 ) The STL provides similiar classes called stack and
queue, both of which gave functions...
asked 5 hours ago -
For Questions 1-4, assume you have 5 bits available:
1. For (positive) integers: What is the...
asked 5 hours ago -
convert grams into vloume with the density of water being at
.997514 g/cm^3 at 23.1 Celsuis...
asked 8 hours ago -
Foreman company obtained a $20,000, 6% loan on May 1, 2018.
Principal and interest will be...
asked 8 hours ago -
5. Problem 11.05 (Discounted Payback)
eBook
Project L costs $60,000, its expected cash inflows are $14,000
per...
asked 8 hours ago -
1. Which of the following is true about politics and health
organizations?
A. Health organizations are...
asked 8 hours ago -
A space vehicle is coasting at a constant velocity of 18.1 m/s
in the +y direction...
asked 9 hours ago -
5) Use the following balanced equation to answer questions
(a)-(i).
3 Cu(s) + 8 HNO3(aq) →...
asked 9 hours ago