which component determines how long an mRNA transcript remains in a cell (the half-life of the...
Homework Answers
The poly A tail is the component which determines the half life of the mRNA transcript.The poly A tail is the adenine nucleotide which is added to the 3' end of the mRNA in the nucleus. It helps to stabilize the mRNA during the transport of mRNA from nucleus to cytoplasm. It is also involved in binding of the proteins involved in translation.
Add Answer to:
which component determines how long an mRNA transcript remains
in a cell (the half-life of the...
Question 14 (2 points): Processing of a primary mRNA transcript in a eukaryotic cell DOES NOT...
Question 14 (2 points): Processing of a primary mRNA transcript in a eukaryotic cell DOES NOT involve: A. Excision of non-coding sequences (introns). B. Addition of the 7-methylguanosine cap at the 5'-end. C. Charging of an amino acid residue to the CCA-end. D. Joining of coding sequences (exons). E. Attachment of a long poly(A) sequence at the 3'-end.
which type of RNA is responsible for bringing the correct amino acids to the mRNA transcript
which type of RNA is responsible for bringing the correct amino acids to the mRNA transcript
Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript...
Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript containing 1200 bases, which is translated into a protein containing 300 amino acids. A. How long is the coding sequence in this mRNA and how many nucleotides are in the UTRs? For the purposes of this question we are ignoring the G’ cap and the polyA tail. B. A mutant form of the gene created by one nucleotide being changed to another nucleotide also...
1.A The mRNA sequence below is the full length of the mature mRNA transcript. On the...
1.A The mRNA sequence below is the full length of the mature mRNA transcript. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. This transcript arrives at a ribosome. Determine the anticodon sequence for the first three tRNA used to make the polypeptide. Label the 5’and 3’ends on the tRNAs. 5' AAUCGAUGUAAUCCGCAUC 3' B. Hydrolysis reactions They do so by link monomers to form a polymer; adding a water molecule remove monomers from...
The half life of cobalt 60 is 5.3 years. How long will it take a 4.8g...
The half life of cobalt 60 is 5.3 years. How long will it take a 4.8g sample of Co60 to decay until only 1.6g of Co60 remains in the sample?
Sr-90 has a half-life of 29.1 years. How long will it take for the activity of...
Sr-90 has a half-life of 29.1 years. How long will it take for the activity of a Sr-90 sample to decay from 5.3 times 10^3 dpm (disintegrations per minute) to 3 times 10^2 dpm? The half-life of a radioisotope is 3 d. What percent remains after 1 week?
3. During translation, explain how the cell determines where to start and stop the protein synthesis...
3. During translation, explain how the cell determines where to start and stop the protein synthesis when an mRNA template is given
1. How long would the peptide encoded by this bacterial mRNA be if it were translated...
1. How long would the peptide encoded by this bacterial mRNA be if it were translated in a eubacterial cell? 5'UAUGAGGAGGUAUGCAUGAAUCGGUAGCCUAACGGAUUCC3' ____ 2. How long would the peptide encoded by this eukaryotic mRNA be if it were translated in a eukaryotic cell? 3'-mG5'5'-GUACCAUGGCCAGGAGGUGAAUGUUCCAUGCAUCGGUAGCCUAACCAACGAUUUCUGCAAAAAAAAAAAAAAAAA3'
The half-life of tungsten-187 is 0.9875 days. How much of a 10.0 gram sample remains after...
The half-life of tungsten-187 is 0.9875 days. How much of a 10.0 gram sample remains after 71.1 hours? 1.25 g 5.00 g 2.50 g Not enough information is given.
The half-life of tungsten-187 is 0.9875 days. How much of a 10.0 gram sample remains after...
The half-life of tungsten-187 is 0.9875 days. How much of a 10.0 gram sample remains after 71.1 hours? O 1.25 g O 5.00 g 0 2.50 g O Not enough information is given.
Question 14 (2 points): Processing of a primary mRNA transcript in a eukaryotic cell DOES NOT involve: A. Excision of non-coding sequences (introns). B. Addition of the 7-methylguanosine cap at the 5'-end. C. Charging of an amino acid residue to the CCA-end. D. Joining of coding sequences (exons). E. Attachment of a long poly(A) sequence at the 3'-end.
1.A The mRNA sequence below is the full length of the mature mRNA transcript. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. This transcript arrives at a ribosome. Determine the anticodon sequence for the first three tRNA used to make the polypeptide. Label the 5’and 3’ends on the tRNAs. 5' AAUCGAUGUAAUCCGCAUC 3' B. Hydrolysis reactions They do so by link monomers to form a polymer; adding a water molecule remove monomers from...
Sr-90 has a half-life of 29.1 years. How long will it take for the activity of a Sr-90 sample to decay from 5.3 times 10^3 dpm (disintegrations per minute) to 3 times 10^2 dpm? The half-life of a radioisotope is 3 d. What percent remains after 1 week?
3. During translation, explain how the cell determines where to start and stop the protein synthesis when an mRNA template is given
The half-life of tungsten-187 is 0.9875 days. How much of a 10.0 gram sample remains after 71.1 hours? 1.25 g 5.00 g 2.50 g Not enough information is given.
The half-life of tungsten-187 is 0.9875 days. How much of a 10.0 gram sample remains after 71.1 hours? O 1.25 g O 5.00 g 0 2.50 g O Not enough information is given.
Most questions answered within 3 hours.
-
Suppose you are analyzing a competitor of Levi's Luxury Shop and
determine that Current Assets are...
asked 4 minutes ago -
statistics show
that 40% of adults sleep with socks. Eight adults are randomly
selected
what is...
asked 11 minutes ago -
In
a blast furnace, coke, which is solid carbon, reacts with O2(g) to
form carbon monoxide....
asked 18 minutes ago -
1) A charge of 1.15 mC is placed at each corner of a square
0.170 m...
asked 25 minutes ago -
Early in 2013, Beech Aircraft acquired 9 acres of land and
engaged Wal-Mart to design and...
asked 22 minutes ago -
Write a int function that accepts as parameter the name of a
candidate and return the...
asked 27 minutes ago -
explain the diffrence between 'orientation polarization' and
'distortion polarization'.
(It's hard to recognize, so please explain...
asked 25 minutes ago -
Bombs Away Video Games Corporation has forecasted the following
monthly sales:
January
$
114,000
July...
asked 28 minutes ago -
Calculate the equilibrium concentration of
PO43- in a saturated aqueous solution of
Ca3(PO4)2. The Ksp value...
asked 35 minutes ago -
The state education commission wants to estimate the fraction of
tenth grade students that have reading...
asked 46 minutes ago -
When a scientist conducted a genetics experiments with peas,
one sample of offspring consisted of 905...
asked 40 minutes ago -
(a) Subtract (78) in base 10 from (97) in base 10 using 2's
complement arithmetic ,...
asked 43 minutes ago