GMO Foods Assignment. Answer the question below in paragraphs format.
What is DNA isolation?
What is PCR
what is CaMV promoter?
What is cyf1 gene?
What is and plant chloroplast and positive control?
A) DNA Isolation:
DNA isolation can be described as a process of obtaining/extracting purified DNA from various sources. Source can be bacteria, blood, tissue, hair, semen etc.
There are various methods of DNA isolation depending on the type of source.
If you have tissue as a source, you can homogenise it; either chemically or mechanically. Rupturing of cell wall can be done by lysozyme (in case of bacteria) and zymolase in case of yeast or fungi. Cell membrane can then be ruptured by using detergents such as SDS or by using proteinases, or chelators such as EDTA or Urea.
BASIC STEPS INVOLVED IN ALL DNA EXTRACTION METHODS ARE AS FOLLOWS:
B) PCR
POLYMERASE CHAIN REACTION was formulated in 1985 by KERRY MULLIS. It is used to obtain selective amplification of a specific target DNA sequence within a collection of DNA sequence. To do so, some prior DNA sequence information from the target sequence is required. This information can then be used to design two primers(oligonucleotide) which are specific to the target sequence ans usually 15-25 nucleotides long.
Primers are then added to denatured template DNA and then they bind specifically to complementary DNA sequences at the target site. Suitable heat stable DNA polymerases such as Taq polymerase and DNA precursors, the DNA triphosphates dATP, dCTP, dGTP, dTTP are used. The role of primer is to initiate the synthesis of new DNA strands which are complementary to target DNA segment and will overlap each other.
C) Cauliflower mosaic virus promoter is 35S promoter which is widely used in all GM crops,especially GM maize. It is a constitutive promoter.This promoter is not only active in plants but also in the gut of E. coli , in yeast and in extracts of cancer cell lines of humans. This promoter is used to activate artificially inserted foreign genes in transgenic plants. It can also be used for detection of genetically modified organisms by targeting different regions of this promoter.
GMO Foods Assignment. Answer the question below in paragraphs format. What is DNA isolation? What...
84) Refer to the following gels and answer the questions below (7 pts) B. 1) "non-GMO" test sample, plant mastermix 2) "non-GMO test sample, GMO mastermix 3) "GMO' test sample, plant mastermix 4) "GMO test sample, GMO mastermix 5) GMO purified DNA, plant mastermix. 6) GMO purified DNA, GMO mastermix 7) Molecular weight marker Which gel has the pattern you would predict to see if: A) The DNA extraction didn't work? B) The test food was a GMO and the...
What is DNA isolation? Group of answer choices The extraction of DNA from viruses or cells. The rupturing of the DNA molecule. The moving of DNA from 1 cell to another. Copying of the DNA molecule. Measuring the DNA molecule for transport.
- Please answer the following questions (no more than 350 words), 1- What is GMO? What are the advantages of GMOs (2 advantages)? (3 pts) 2- Why should we extract DNA from food samples in Lab #9 (week 13)? (3 pts) 3- If you had a chance to conduct the lab #9 experiments, what results do you expect to get from this lab (by analyzing your gel)? (4 pts) Please note that Plant master mix (MM) (green) means that we...
PLEASE ANSWER ALL THE QUESTIONS: 1.What is true of tRNA (transfer RNA)? A they contain an anti-codon B they carry an amino acid C they can interpret the genetic code D all of these are true 2. How can transcription factors bound to distant enhancers influence gene expression? A the transcription factors can slide along the DNA until they get to the gene's promoter B DNA can loop, bringing these proteins into contact with the gene's promoter C both of...
QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features of a "gene have been left out of this segment (eg promoter, terminator). Assume that the direction of movement of the RNA polymerase is from right to left (draw this on a piece of paper so that you can see it S ATAQOCATTCCATACCCAAS AGOTATGGGTT-T True or False The TOP strand serves as the template strand that you can see it) QUESTION / Consider the...
The sequence below represents the first section of the template strand of DNA of a structural gene in an prokaryotic organism. Position +1 is shown in orange. Please fill in the blanks that correspond YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written 3 GTAACTĀTAATTACGCGTATAATGAT 5 What would be the nucleotides that form the promoter? What would be the 5'UTR sequence? What would be the sequence...
*Microbiology. Please answer the below question. The current selected answer is incorrect. Thank you! Incorrect 0/1 pts Question 1 Which of the following PCR components serves as the template? a. Target gene sequence • b. Synthetic primers c. Deoxyribonucleotides d. DNA polymerase III
Answer the following questions that do not have an answer. Creating a graph is not necessary. Thanks!!! You introduced the pGlo vector into E. coli which carried the GFP gene under the control of the arabinose promoter. Based on what you know about the arabinose promoter, when did you expect GFP to be expressed? I expected the green fluorescence protein to be expressed when arabinose was present. What hypothesis was tested by the experiments you performed after the pGlo vector was...
Please answer the following question in a one or two paragraphs not as bullet points format. Question: Describe how you might achieve a greater certainty of knowledge within your discipline and discuss how you might apply such certainty to your interactions with patients. Thank you.
Question 9 (1 point) Given the two complementary DNA sequences below from an E. coli gene promoter region, match the following labels to the appropriate strand. ACGTGTAACTGTTAATCTAGTACAGCTACATATTAGTGAGATAAT 1. Non- template TGCACATTGACAATTAGATCATGTCGATGTATAATCACTCTATTA 2. Template