Homework Answers
a. Target gene sequence
the template for the PCR technique is template DNA , i.e. DNA containing the gene sequence that is to be copied.
PCR is a technique used to produce multiple copies of a DNA strand. The components of this reaction include template, primer, DNA polymerase and free nucleotides. In this method the DNA template is added to a tube containing primers, nucleotides and DNA polymerase. This is processed through various temperatures and the DNA polymerase enzyme synthesise the copies of template starts from primers. The new strands act as template for the next cycle of PCR.
PCR method is mainly used for clonning, forensic testing of DNA and for disease diagnosis.
Add Answer to:
*Microbiology. Please answer the below question. The current
selected answer is incorrect. Thank you!
Incorrect 0/1...
*Microbiology. Please answer the below two multiple choice questions. The current selected answers are incorrect. Thank...
*Microbiology. Please answer the below two multiple choice
questions. The current selected answers are incorrect. Thank you,
will provide positive feedback for correct answers!
Incorrect Question 3 0/1 pts The replication fork has both leading (continuous) and lagging (discontinuous) synthesis because: a. The origin of replication only allows DNA synthesis to occur in one direction around the chromosome. b. Primase only works on the leading strand c. Helicase is slow in unwinding the double helix so the polymerization moving toward...
please answer this question with a correct and concise explanation, thank you so much! 1 QUESTION...
please answer this question
with a correct and concise explanation, thank you so much!
1 QUESTION 6 What is the difference in the contents of a PCR reaction vs a sequencing reactions? a. Presence of DNA polymerase vs RNA polymerase b. Primers C. ddNTPs d. Template DNA e. dNTPs
Please help me with these questions. Thank u very much. Q1: A DNA sample from an...
Please help me with these questions. Thank u very much. Q1: A DNA sample from an individual is analyzed. The population frequency of one of the STR alleles is 1 in 50, a second STR allele is 1 in 100, and a third STR allele is 1 in 30. What is the combined frequency of these three STR alleles? a.1 in 150,000 b.1 in 15,000 c.1 in 1,500 d.1 in 180 e.1 in 50 Q2: Which of the following hybridize...
Now. you should be able to answer the following questions: • How the amplification will be...
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
QUESTION 8 List the components used in PCR versus the components used in qPCR. QUESTION 1...
QUESTION 8 List the components used in PCR versus the components used in qPCR. QUESTION 1 Which of the following is not valid about how Primers work for PCR Having a sequence that anneals in the range of 56°C to 60°C depending upon design. Having the same sequence as the 'template DNA' in the gene of interest, about 20-30bp in length. Using sequences that are as close to 50% GC vs AT as possible. Using a sequence complementary to the...
NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS WELL. THANKSSSSSSS 1. You want...
NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS
WELL. THANKSSSSSSS
1. You want to clone a gene from a donor vector to a host vector. List the correct order of events in the process of cloning a. Perform ligation reaction of cloned gene and host vector. b. Perform double digestion of both donor and host vectors with the 2 restriction enzymes c. Examine donor and host vectors for restriction sites d. Purify cloned gene from donor vector...
0/5 pts Incorrect Question 15 The sequence below represents a middle section of the template strand...
0/5 pts Incorrect Question 15 The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3CATGGACAGgtaagaatacaacacagGTCGGCATGACG5 GUACCUGU cauuuuauguuguguCCAGCCGUACUGC What would be...
please help with all 3 Incorrect Question 19 0/10 pts The sequence below represents the first...
please help with all 3
Incorrect Question 19 0/10 pts The sequence below represents the first section of the coding strand of DNA of a structural gene in an prokaryotic organism. Position +1 is shown in orange. Please fill in the blanks that correspond. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. 5' GTAACTATAATTATGCGTATAATG 3' What would be the nucleotides that form the promoter? GUAACUAU...
QUESTION 1: You are inserting a gene into an MCS found within the LacZ gene. Using...
QUESTION 1: You are inserting a gene into an MCS found within the LacZ gene. Using blue/white colony selection, why could you assume that white colonies have modified plasmids? a. A blue colony means the LacZ reading-frame was disrupted b. A blue colony means your gene has mutations c. A white colony means the LacZ reading-frame is intact d. A white colony means the LacZ reading-frame was disrupted QUESTION 2: You are performing a PCR using primers with a sequence perfectly...
Write neat please and box the final answer please Question 5 0.5 pts Before the lagging...
Write neat please and box the final answer please
Question 5 0.5 pts Before the lagging strand can begin assembling new DNA nucleotides, which of the following must occur? OH bonds must be broken between the two strands of DNA DNA polymerase I removes some material and replaces it with DNA ORNA primase constructs a short RNA primer. DNA Ligase forms a phosphodiester bond between the 3'OH of the growing strand and the 5' phosphate in front of it. DNA...
*Microbiology. Please answer the below two multiple choice
questions. The current selected answers are incorrect. Thank you,
will provide positive feedback for correct answers!
Incorrect Question 3 0/1 pts The replication fork has both leading (continuous) and lagging (discontinuous) synthesis because: a. The origin of replication only allows DNA synthesis to occur in one direction around the chromosome. b. Primase only works on the leading strand c. Helicase is slow in unwinding the double helix so the polymerization moving toward...
please answer this question
with a correct and concise explanation, thank you so much!
1 QUESTION 6 What is the difference in the contents of a PCR reaction vs a sequencing reactions? a. Presence of DNA polymerase vs RNA polymerase b. Primers C. ddNTPs d. Template DNA e. dNTPs
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
QUESTION 8 List the components used in PCR versus the components used in qPCR. QUESTION 1 Which of the following is not valid about how Primers work for PCR Having a sequence that anneals in the range of 56°C to 60°C depending upon design. Having the same sequence as the 'template DNA' in the gene of interest, about 20-30bp in length. Using sequences that are as close to 50% GC vs AT as possible. Using a sequence complementary to the...
NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS
WELL. THANKSSSSSSS
1. You want to clone a gene from a donor vector to a host vector. List the correct order of events in the process of cloning a. Perform ligation reaction of cloned gene and host vector. b. Perform double digestion of both donor and host vectors with the 2 restriction enzymes c. Examine donor and host vectors for restriction sites d. Purify cloned gene from donor vector...
0/5 pts Incorrect Question 15 The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3CATGGACAGgtaagaatacaacacagGTCGGCATGACG5 GUACCUGU cauuuuauguuguguCCAGCCGUACUGC What would be...
please help with all 3
Incorrect Question 19 0/10 pts The sequence below represents the first section of the coding strand of DNA of a structural gene in an prokaryotic organism. Position +1 is shown in orange. Please fill in the blanks that correspond. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. 5' GTAACTATAATTATGCGTATAATG 3' What would be the nucleotides that form the promoter? GUAACUAU...
Write neat please and box the final answer please
Question 5 0.5 pts Before the lagging strand can begin assembling new DNA nucleotides, which of the following must occur? OH bonds must be broken between the two strands of DNA DNA polymerase I removes some material and replaces it with DNA ORNA primase constructs a short RNA primer. DNA Ligase forms a phosphodiester bond between the 3'OH of the growing strand and the 5' phosphate in front of it. DNA...
Most questions answered within 3 hours.
-
1980
1985
1990
1995
2000
2005
Pi(0); Qi(O)
(1);(1)
Apples
.692,19.2
.684,17.3
.719,19.6
.835,18.9
.927,17.5
.966,16...
asked 20 seconds from now -
Using the data in the following table, calculate:
A. Average return and standard deviation for each...
asked 13 minutes ago -
A health care professional wishes to estimate the birth weights
of infants. How large a sample...
asked 29 minutes ago -
You are the manager for a large department within a company, and
you have received a...
asked 22 minutes ago -
Name and draw the chemical structure of the three aromatic amino
acids. Which groups in an...
asked 30 minutes ago -
The forelimb bones of a cat are ____________ to the forelimb
bones of a bird. The...
asked 33 minutes ago -
What is the standard cell potential of the following
reactions
a. F2 + 2Cl- → 2F-...
asked 35 minutes ago -
1. What is an instruction trace?
2) What common events lead to the creation of a...
asked 38 minutes ago -
What would be the consequences if every organization used
different rules and definitions for how it...
asked 42 minutes ago -
Examine the properties (memory, stability, casuality, linearity,
and time-invariance) for the following systems
(a) y(t) =...
asked 47 minutes ago -
How does MDMA inhibit cytochrome P450 ?
asked 52 minutes ago -
How do you draw a bode plot for:
a.) (2s) / (s+100)
b.) (((2)(s+100)) / (s^2...
asked 58 minutes ago