Biochemistry What is the protein domain in the context of a sequence alignment algorithm? How do you identify domain sin...
Biochemistry
What is the protein domain in the context of a sequence alignment algorithm? How do you identify domain sin PFam?
Homework Answers
- Protein domain in context of a sequence alignment algorithm
- Identification of domain sin PFam
Add Answer to:
Biochemistry What is the protein domain in the context of a sequence alignment algorithm? How do you identify domain sin...
Biochemistry How do you identify the most conserved residues in a protein superfamily identification?
Biochemistry How do you identify the most conserved residues in a protein superfamily identification?
what is the Manhattan tourist problem. How does this algorithm related to sequence alignment?
what is the Manhattan tourist problem. How does this algorithm related to sequence alignment?
Genetics - Question 4 [15 marks] Sequence alignment is a critical tool for the analysis of genome data. Explain the pur...
Genetics - Question 4 [15 marks] Sequence alignment is a critical tool for the analysis of genome data. Explain the purpose of alignment scores in identifying the best alignments. [5 marks] What is the general concept upon which all protein scoring matrices are based? [3 marks] What is the difference between PAM and BLOSUM scoring matrices? [2 marks] You have a DNA sequence from a new microorganism. You search the NCBI nonredundant nucleic acid database using BLASTN. Surprisingly, you do...
How faithfully is DNA sequence maintained from one generation to the next? What is the estimated mutation rate of an average protein/gene? How do you estimate mutation rate? What do you know about DNA...
How faithfully is DNA sequence maintained from one generation to the next? What is the estimated mutation rate of an average protein/gene? How do you estimate mutation rate? What do you know about DNA repair? (as a result of deamination and depurination)
2. It has been established that the so-called ‘ ZZ domain’, a synthetic IgG binding protein...
2. It has been established that the so-called ‘ ZZ domain’, a synthetic IgG binding protein derived from tandem repeats of the B domain of protein A, interacts with the Fc portion of IgG molecules. HOW would you confirm that this ‘ ZZ domain’ indeed binds to the Fc region of IgG and not to that of IgM or IgE a.What would you establish as criteria for physiologically relevant binding of this ZZ domain to IgG Fc portion? b.What would...
300 Full length protein Mutant protein 1 Mutant protein 2 75 300 1 250 Mutant protein...
300 Full length protein Mutant protein 1 Mutant protein 2 75 300 1 250 Mutant protein 3 (fig69) 300 100 1 225 Mutant protein 4 Mutant protein 5 100 225 No protein Full length protein Mutant protein 1 Mutant protein 2 Mutant protein 3 Mutant protein 4 Mutant protein 5 (fig70) - In addition to cloning normal full length MYC, you make a series of mutant versions to identify the key functional domains of the protein. Based on similarity to...
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be...
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...
In Biochemistry- How do you know if you need to use the quadratic equation for weak...
In Biochemistry- How do you know if you need to use the quadratic equation for weak acid problems? (Or, how do you know that the “x is small assumption” is correct?) Why does this work?
You've identified a gene likely involved in a human disease. You BLAST the predicted protein sequence...
You've identified a gene likely involved in a human disease. You BLAST the predicted protein sequence for the gene against the database of known protein sequences and see that a domain of your unknown protein is similar to the nuclease domain of a RISC complex protein. Therefore... Select one: a. The unknown protein is likely a component of the RISC complex b. The unknown protein is likely to be a restriction endonuclease c. The unknown protein is likely to be...
300 Full length protein Mutant protein 1 Mutant protein 2 75 300 1 250 Mutant protein 3 (fig69) 300 100 1 225 Mutant protein 4 Mutant protein 5 100 225 No protein Full length protein Mutant protein 1 Mutant protein 2 Mutant protein 3 Mutant protein 4 Mutant protein 5 (fig70) - In addition to cloning normal full length MYC, you make a series of mutant versions to identify the key functional domains of the protein. Based on similarity to...
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...
You've identified a gene likely involved in a human disease. You BLAST the predicted protein sequence for the gene against the database of known protein sequences and see that a domain of your unknown protein is similar to the nuclease domain of a RISC complex protein. Therefore... Select one: a. The unknown protein is likely a component of the RISC complex b. The unknown protein is likely to be a restriction endonuclease c. The unknown protein is likely to be...
Most questions answered within 3 hours.
-
A single NEC SX-9 vector processor unit (VPU) has a peak
arithmetic
performance of 102.4 GFs/s....
asked 6 minutes ago -
. Determine the hourly multiplication factors
such that the total daily water consumption will equal 15,000...
asked 7 minutes ago -
A budgeting Web site reported that 35% of U.S. households have
withdrawn money from a 401(k)...
asked 6 minutes ago -
In this assignment, you will write a minimum two-page paper that
explains the treatment of internal...
asked 10 minutes ago -
Direct marketing is also referred to as Question 50 options: 1)
one-to-one marketing. 2) business-customer marketing....
asked 13 minutes ago -
INK Ltd is grocery retailer with 103 shops around South
Australia and Tasmania. The company has...
asked 18 minutes ago -
HOW BEER IS MADE
The beer making process is an art. It takes time, patience and...
asked 19 minutes ago -
What two methods could be used to purify the dimethyl
fumarate?
Based on the 12 Principles...
asked 29 minutes ago -
Reflect upon the readings and videos as well as our Media Monday
discussion. Integrating concepts from...
asked 34 minutes ago -
1. A cylindrical capacitor with A = 0.01, B = 0.1 and a length
of 5...
asked 40 minutes ago -
Explain how taking an SGLT-2 inhibitor, along with taking
insulin leads to ketoacidosis in people who...
asked 49 minutes ago -
Show the truth table of the
gates needed to control the PISO internal FF, has a...
asked 53 minutes ago