Designing primers for PCR amplification of a DNA sequence
Given the following short DNA duplex of sequence (5'*3')
ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCACACATGCACACACATGACATAGGACAGATAGCAT
what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex?
We need at least 10 more requests to produce the solution.
0 / 10 have requested this problem solution
The more requests, the faster the answer.