Answer: Loss of a base from a position in DNA is a mechanism of : " Mutation".
This will comes under the category of point mutation. A point mutation is a type of mutation in which a single nucleotide base is changed , deleted or inserted in the DNA.
Question 34 (1 point) Saved Loss of a base from a position in DNA (an abasic...
z Instructions Question 1 (Q039) In addition to the repair of DNA double-strand breaks, homologous recombination is a mechanism fe generating genetic diversity by swapping segments of parental chromosomes. During which process does swapping occur? DNA replication ODNA repair O meiosis transposition No new data to save. Last checked at 8:05am
QUESTIONS During replication the protein that keeps the two stands of DNA from popping back together is called Gene Semiconservative SSB Single Stranded Binding Protein ODNA polymerase QUESTION 2 Tachnow molecule of DNA is a double he which is made up of O two new stands of DNA one new strand and one old strand of DNA two old stands of DNA o the new strands of DNA QUESTIONS QUESTION 19 The process of synthesizing RNA from a specific sequence...
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...
Question 7 (1 point) Saved DNA replication occurs through the semi-conservative replication mechanism; what was observed in the Meselson and Stahl experiment, in which DNA purified from E. coli growing on 14N-medium was centrifuged in a density gradient tube, by the third generation of DNA replication? One band representing "light" DNA OTwo bands: a light density band and a faint hybrid density band Three bands: one each of light density, hybrid density, and high density bands One band representing "heavy"...
Question 34 12 pts Indicate whether the following statements are true for DNA replication only (type DNA next to the statement), RNA transcription only (type RNA next to the statement); both replication and transcription (type BOTH next to the statement); or neither replication or transcription (type NONE next to the statement). (10 points, 2 points each) A. The new strand is synthesized in the 3' to 5' direction. B. A primer is required. C. A template is required. D. Polymerases...
Question 1 (1 point) Saved Which of these processes must precede fertilization? a) oxidation O b) respiration Oc) mitosis Od) meiosis O e) mutation Question 2 (1 point) Which of the following diseases is not hereditary? O a) sickle-cell anemia O b ) cystic fibrosis c) diabetes d) arthritis O e) none of the above Question 3 (1 point) was an early pioneer in the field of genetics with his famous experiments with pea plants. a) Mendel Ob) Linnaeus OC)...
1.Which of the following DNA repair systems involving DNA N-glycosylasesrecognizes an abnormal DNA nucleotide (i.e. uracil) and cleaves the bond between it and the sugar? - Mismatch repair -Base excision repair -Non-homologous end-joining repair -Homologous recombination repair 2. self-splicing is the most common mechanism for splicing mRNA transcribed from eukaryotic, nuclear, structural genes - true or false 3. True or False, during elongation of transcription, RNA polymerase is primarily in a closed complex
allll pleas Question 14 (1 point) Eukaryotes modify a primary RNA transcript to generate a final mRNA product. Which of the following modifications is something that occurs to eukaryotic RNA (which one is correct): OA) removing exons from the transcript B) adding introns into the transcript C) adding a poly(A) tail to the transcript by poly(A) polymerase OD) adding start codons to the transcript after its synthesis E) removing a 5' cap from the transcript Question 18 (1 point) Origins,...
Answer the questions: Question 1 Transcription begins at the..... a. operon o b. repressor c. genome 17d. promoter Question 2 0.5 points Save RNA is synthesized on a DNA template in a process called replication, DNA polymerase translation, RNA polymerase transcription, RNA polymerise t ranscription, DNA polymerase Question 3 Which eukaryotic RNA polymerase makes tRNA's? a RNA polymerase IIIb. Any of these RNA polymerase I od RNA polymerase II A Moving to another question will save this response. Question 4...
1 pt 1 Question 1 Why must one strand of DNA be replicated in fragments? DNA polymerase can only add 20 nucleotides in a strand and then must start over ODNA polymerase can only add nucleotides to the 3 hydroxyl of a growing strand O it would be too crowded for two DNA polymerases to be going in the same direction all of the above Question 2 1 pt the DNA would spin and possibly break while being opened in...