A) Nonsense mutation: It is defined as the mutation in which sense codon is mutated into the termination codons.
There is found stop codon formation between the codon sequence. This leads to short polypeptide formation as comapred to normal polypeptide. That's why this mutation is harmful.
B) Neutral mutation: It is defined as the mutation in which the amino acid in a polypeptide chain is not altered by the mutation.
This mutation is neither beneficial nor harmful in nature. Because amino acid is same as found in wild type.
C) Induced mutation: The mutation which are induced by means of chemicals, X-rays and UV rays etc.
This mutation can be beneficial as well as harmful.
please rate.
. (3 points) Provide definitions for each of the following and indicate if the effects are...
3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the transcript: AUU UCU VUA GCA AGA GCU... Al The corresponding amino acids in the normal CFTR protein are: (Use either the one-or three-letter amino acid codes A naint mutation changes the last nucleotide from U to C. At the DNA level, this is a transition transversion c) At the protein level, this is a (silent / missense / nonsense/frameshift ) mutation. D) Instead of...
1. Which of the following mutations is the most likely to be neutral? A) A nonsense mutation in exon 5 of a gene with 39 exons. B) A splice site mutation in intron 3 of a gene with 8 introns and 9 exons. C) A single nucleotide insertion in exon 7 of a gene with 18 exons. D) A thee nucleotide deletion in exon 1 of a gene with 7 exons.
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4 Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...
3. (21 points) Provide the major product for each reaction below. Be sure to indicate appropriate stereochemistry when relevant ОН HB 90°C Xusuguay Br CH.CH, ONA CH,CH,OH * NaN acetone-water (solvent) 9. H.Co
*Hint: You will have one of each type. Types of Mutations? Point - Missense Frameshift - Insertion Point - Nonsense Frameshift Deletion Point - Silent Original DNA Sequence: TACACCTTGGCGACT mRNA Sequence: AUG Amino Acid Sequence: Mutated DNA Sequence #1: TACATCTTGGCGACT What's the mRNA sequence? (Circle the change) AUG TALAALLA What will be the amino acid sequence? Will there likely be effects?_ What kind of mutation is this? Mutated DNA Sequence 12: TACGAC CTTGGCGACT What's the mRNA sequence? (Circle the change)...
11. Match each type of mutation with the corresponding description. (4 points) Missense An insertion or deletion of nucleotides that are not in multiples of 3. Nonsense A mutation that does not alter the protein sequence. Silent A mutation that confers an amino acid substitution. Frameshift A mutation that confers a premature stop codon.
Debit and Credit Effects Indicate the account that will be debited for each of the following transactions: a. Issued common stock for cash b. Borrowed money from a bank c. Provided services on account d. Purchased inventory on account e. Collected cash from customers that owed a balance due
Debit and Credit Effects Indicate the account that will be credited for each of the following transactions: a. Issued common stock for cash b. Borrowed money from a bank c. Provided services on account d. Purchased inventory on account e. Collected cash from customers that owed a balance due
For each of the following species, indicate whether the resulting solution would be acidic, basic, or neutral, if 0.50 mole of each were dissolved in 1.0 liter of water. Provide the predominant acid-base reaction that would occur. Substance: A) NH4NO3 B) Potassium Iodide C) Sodium Fluoride. Determine if each of them is Acidic/Basic/Neutral and Predominant Reaction that occurs
Identify the downstream effects of the following mutations in lambda phage. Explain how each mutation would then favor the lysogenic or lytic cycles: A) mutation on the cIII gene. B) A mutation on PRM, C) A mutation on the N gene