In this schematic, _______ represents a gene (DNA) that is transcribed and processed to form ______, which are mRNA molecules. ______ represents one protein produced from the gene. The molecule that will function as a transcription factor is ______.
For each blank, the options are Molecule A, Molecule B, Molecule C, Molecule D, and Molecule B and C.
Thank you so much for your help!
Homework Answers
In the above picture, Molecule A represents the DNA sequence or gene that is transcribed and processed into mRNA molecules that are represented by Molecule B and C. Molecule D represents the protein translated from this gene. Molecule D will function as a transcription factor as it contains a DNA binding domain and an activation domain that will recruit the transcription machinery.
Add Answer to:
In this schematic, _______ represents a gene
(DNA) that is transcribed and processed to form
______,...
3. This is a schematic of a very simple pattern of gene expression. Yes means the...
3. This is a schematic of a very simple pattern of gene expression. Yes means the protein is present and can bind the promoter. No means the protein is absent. Transcription factors are proteins that help regulate transcription by binding DNA Activators are transcription factors that help transcription. For example, they bend the promoter and make it accessible to RNA polymerase. Repressors are transcription factors that inhibit transcription. For example, they might bind the promoter and stop the RNA polymerase...
Question 19 Not yet answered The following diagram represents a replication bubble. The grey circles represents...
Question 19 Not yet answered The following diagram represents a replication bubble. The grey circles represents 4 molecules of DNA polymerase III siting on a template strand and ready to add new nucleotides to the RNA primers (not shown). Which of the 4 DNA pol III molecules will create okazaki fragments? Points out of 2.50 P Flag question A B 5' 3' Select one: o a. Cand D O b. Only A O c. B and C O d. A...
Draw a Eukaryotic Gene Schematic Draw features of importance at the DNA level Transcription start site...
Draw a Eukaryotic Gene Schematic Draw features of importance at the DNA level Transcription start site +1 Promoter - as much detail as you can Gene start ATG and stop codons Transcription Regulatory Sequences such as activators/repressors and enhancers/insulators Draw features of importance at the pre-mRNA level Designate Introns and Exons Designate important Sequences to direct and regulate splicing three important sequences for the chemistry of splicing splicing regulatory sequences (ISS, ISE, ESE, ESS) Modifications at level of pre-mRNA UTRs,...
DNA polymerases are processed, which means that they remain tightly associated with the while moving rapidly...
DNA polymerases are processed, which means that they remain tightly associated with the while moving rapidly and adding nucleotides to the growing daughter strand. Which piece of the machinery accounts for this characteristic? (a) helicase (b) sliding elamp (c) single-strand binding protein (d) primase RNA in cells differs from in that _____ (A) it contains the base uracil, which pairs with cytosine (b) it is single stranded and cannot form base pairs (c) it is single stranded and can fold...
Match each term associated with genes and control of gene expression with the appropriate description. A...
Match each term associated with genes and control of gene expression with the appropriate description. A transcriptional unit" that consists of promoter multiple genes under the control of a single regulatory element. A transcriptional regulatory protein (prokaryotic or eukaryotic) which works by turning on or increasing gene transcription. activator The region of a gene to which RNA polymerase binds. Enhancer A transcriptional regulatory protein prokaryotic or eukaryotic) which works by turning off or decreasing gene transcription. repressor A molecule that...
Below is a schematic of gene Hemoglobin beta subunit (HBS), which encodes protein HBS. The promoter...
Below is a schematic of gene Hemoglobin beta subunit (HBS), which
encodes protein HBS. The promoter region is indicated by the dotted
box. Transcriptions begins immediately following the promoter. The
mature mRNA produced by this gene would be approximately how many
nucleotides long?
A) 100
B) 200
C) 3000
D) 5000
E) 7000
1. Below is a schematic of gene Hemoglobin beta subunit (HBS), which encodes protein HBS. The promoter region is indicated by the dotted box. Transcription begins immediately...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
Question 1 Match the term with the best definition or description; most topics relate to the...
Question 1 Match the term with the best definition or description; most topics relate to the regulation of gene expression. General type of protein which will increase transcription rates when it attaches to a site A. Factor connected to a particular gene - B. Co-repressor C. Enhancer D. Promoter E. Structural F. Intron G. Activator H. Operator I. Basal transcription J. Glucocorticoid receptor K. Sigma factor L. Mediator M. Inducer N. TATA box O. Repressor The rates of mRNA produced...
The transcribed portion of a DNA sequence for a gene is shown below
The transcribed portion of a DNA sequence for a gene is shown below. Identify the mRNA sequence and the polypeptide sequence that would be produced from this gene. Also, identify the specific type of DNA mutation and protein mutation that would result if the underlined A/T basepair was mutated to a C/G basepair. NOTE: Assume RNA polymerase is moving left to right across the page. 3' - TATACGCGATATGGATTC - 5 5'- ATATGCGCTATACCTAAG - 3
Augu Q46. Below is a DNA sequence from a yeast GPCR gene. Using RNA sequencing methods...
Augu Q46. Below is a DNA sequence from a yeast GPCR gene. Using RNA sequencing methods you have obtained the following partial 5' sequence for the MRNA transcribed from this gene: 5'-GGUCCAU... 5'GTATAAGAAGCACTCTACCTCAATGGGTCCATGGGAGAAGGTAGGCATGTGTATTTGACAAAGGGA i. What are the most likely six N-terminal amino acids for the above gene? (2 pts) Examine the other reading frames. Explain why you can exclude those other possible reading frames from consideration (one or two reasons depending upon the frame). (2 pts) Circle the portion of...
3. This is a schematic of a very simple pattern of gene expression. Yes means the protein is present and can bind the promoter. No means the protein is absent. Transcription factors are proteins that help regulate transcription by binding DNA Activators are transcription factors that help transcription. For example, they bend the promoter and make it accessible to RNA polymerase. Repressors are transcription factors that inhibit transcription. For example, they might bind the promoter and stop the RNA polymerase...
Question 19 Not yet answered The following diagram represents a replication bubble. The grey circles represents 4 molecules of DNA polymerase III siting on a template strand and ready to add new nucleotides to the RNA primers (not shown). Which of the 4 DNA pol III molecules will create okazaki fragments? Points out of 2.50 P Flag question A B 5' 3' Select one: o a. Cand D O b. Only A O c. B and C O d. A...
Draw a Eukaryotic Gene Schematic Draw features of importance at the DNA level Transcription start site +1 Promoter - as much detail as you can Gene start ATG and stop codons Transcription Regulatory Sequences such as activators/repressors and enhancers/insulators Draw features of importance at the pre-mRNA level Designate Introns and Exons Designate important Sequences to direct and regulate splicing three important sequences for the chemistry of splicing splicing regulatory sequences (ISS, ISE, ESE, ESS) Modifications at level of pre-mRNA UTRs,...
DNA polymerases are processed, which means that they remain tightly associated with the while moving rapidly and adding nucleotides to the growing daughter strand. Which piece of the machinery accounts for this characteristic? (a) helicase (b) sliding elamp (c) single-strand binding protein (d) primase RNA in cells differs from in that _____ (A) it contains the base uracil, which pairs with cytosine (b) it is single stranded and cannot form base pairs (c) it is single stranded and can fold...
Match each term associated with genes and control of gene expression with the appropriate description. A transcriptional unit" that consists of promoter multiple genes under the control of a single regulatory element. A transcriptional regulatory protein (prokaryotic or eukaryotic) which works by turning on or increasing gene transcription. activator The region of a gene to which RNA polymerase binds. Enhancer A transcriptional regulatory protein prokaryotic or eukaryotic) which works by turning off or decreasing gene transcription. repressor A molecule that...
Below is a schematic of gene Hemoglobin beta subunit (HBS), which
encodes protein HBS. The promoter region is indicated by the dotted
box. Transcriptions begins immediately following the promoter. The
mature mRNA produced by this gene would be approximately how many
nucleotides long?
A) 100
B) 200
C) 3000
D) 5000
E) 7000
1. Below is a schematic of gene Hemoglobin beta subunit (HBS), which encodes protein HBS. The promoter region is indicated by the dotted box. Transcription begins immediately...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
Question 1 Match the term with the best definition or description; most topics relate to the regulation of gene expression. General type of protein which will increase transcription rates when it attaches to a site A. Factor connected to a particular gene - B. Co-repressor C. Enhancer D. Promoter E. Structural F. Intron G. Activator H. Operator I. Basal transcription J. Glucocorticoid receptor K. Sigma factor L. Mediator M. Inducer N. TATA box O. Repressor The rates of mRNA produced...
Augu Q46. Below is a DNA sequence from a yeast GPCR gene. Using RNA sequencing methods you have obtained the following partial 5' sequence for the MRNA transcribed from this gene: 5'-GGUCCAU... 5'GTATAAGAAGCACTCTACCTCAATGGGTCCATGGGAGAAGGTAGGCATGTGTATTTGACAAAGGGA i. What are the most likely six N-terminal amino acids for the above gene? (2 pts) Examine the other reading frames. Explain why you can exclude those other possible reading frames from consideration (one or two reasons depending upon the frame). (2 pts) Circle the portion of...
Most questions answered within 3 hours.
-
2. Binomial Distribution Suppose I have an unfair coin, it lands
on heads 75% of the...
asked 11 minutes ago -
negotiators with absolutely no alternative to a negotiated
agreement sometimes.
a. become hostile and end the...
asked 9 minutes ago -
Write a Verilog program that tests whether a 4-bit input
variable is a Fibonacci number or...
asked 19 minutes ago -
MYSQL
Consider the sql statement "select * from t1 UNION t2" where t1
and t2 are...
asked 22 minutes ago -
2. A retailer sells 10,000 units at $10. Each unit costs the
retailer $7.00 to sell,...
asked 24 minutes ago -
If the Stratosphere elevator in Las Vegas is 500 m above the
ground when the cables...
asked 37 minutes ago -
identify at least one other characteristics of the soils/sand
that may have impacted the growth of...
asked 43 minutes ago -
True or False
The following statements refer to The Web of Belief
10. An explanation of...
asked 45 minutes ago -
15)___________ A study was conducted to
test the effectiveness of aspirin on reducing
asked 52 minutes ago -
How fast must a centrifuge spin if a particle 8 cm from the axis
of rotation...
asked 54 minutes ago -
Which of the following is characteristic of a single exposure
common vehicle outbreak?
a. Wide range...
asked 56 minutes ago -
You are a member of an alpine rescue team and must get a box of
supplies,...
asked 58 minutes ago