Homework Answers
Answer is 1st option that is the first ,third and fourth amino acid are correct, but the second amino acid will be incorrect. Because if first A in sequence got deleted that lead to change in codon that codes for amino acid. As codon changed the particular amino acid will be changed hence option 1st is correct.
Add Answer to:
You are given a DNA sequence that reads: TCGAGGTCACCG If a mutation occurs that causes the...
A DNA coding sequence of ATGCGTGGA(sequence for the rest of the gene)AATTAA encodes a protein chain...
A DNA coding sequence of ATGCGTGGA(sequence for the rest of the gene)AATTAA encodes a protein chain of 200 amino acids of MET-ARG-GLY-(196 more amino acids)-ASN after splicing. A mutation occurs in which the third G is changed to a T. Using the genetic code below, determine which type of mutation this is and briefly explain how translation will be affected for this protein chain.
1) When a mutation occurs by elimination of one base in a DNA sequence, this mutation...
1) When a mutation occurs by elimination of one base in a DNA sequence, this mutation is called a Explain. a) deletion mutation b) substitution (point) mutation c) translocation mutation d) viral mutation 2) Acids and bases denature a protein by disrupting peptide bonds and salt bridges amide bonds and alkene bonds hydrophobic interactions and peptide bonds Aluminum reacts with sulfuric acid. It produces a gas, and an aqueous solution. What mass (in g) of aluminum would completely react with...
4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This...
4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This gene has only one exon meaning no sequence is spliced out during RNA processing. a) What will be the amino acid sequence this gene codes for? 15 points will be given for a completely correct amino acid sequence. You can get partial points if: the beginning of the amino acid sequence is correct (at least two first amino acids, 4 points), and/or the end...
DNA to Protein Describe the mutation that created the HbS allele: type of mutation, location of...
DNA to Protein Describe the mutation that created the HbS allele: type of mutation, location of mutation on HbA sequence (# of bases from beginning of sequence), nucleotide change (from which base to which base?). Describe the effect of this mutation on amino acid sequence of beta-globin polypeptide chain: effect of mutation on codon, which amino acid was changed (# amino acids from beginning of chain), what was the amino acid change (from which amino acid to which amino acid?)...
1. You have used a mutagen to induce mutations in a DNA sequence. If the original DNA...
1. You have used a mutagen to induce mutations in a DNA sequence. If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt) 5'-ATGGGTCTAGATACC-3' 5'-ATGCGACTAGATACC-3' 5'-ATGTGACTAGATACC-3' 5'-ATGGGACTAAGATACC-3' 2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt) silent mutation frameshift mutation missense mutation nonsense mutation 3. Excision repair corrects DNA by (1pt) correcting A=T...
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce...
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you can't find it in one of your biology books). 14) What...
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
Shown below is the anti-sense DNA sequence from a region of a gene that produces a...
Shown below is the anti-sense DNA sequence from a region of a gene that produces a specific protein. Mutations in this region of the gene cause a disease CTT TTA TAG TAG ATA CCA CAA AGG a. What is the mRNA strand that is transcribed from the DNA shown above? b. What is the amino acid sequence that would be translated from the mRNA strand you determined in part 1? c. If an individual has a G at position 15...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
D Question 4 A silent mutation has no change in RNA sequence O no change to...
D Question 4 A silent mutation has no change in RNA sequence O no change to DNA, RNA, or protein O no change in protein sequence O no change in DNA sequence Question 5 Which mutation changes one amino acid for another? nonsense all of these are correct missense silent
1) When a mutation occurs by elimination of one base in a DNA sequence, this mutation is called a Explain. a) deletion mutation b) substitution (point) mutation c) translocation mutation d) viral mutation 2) Acids and bases denature a protein by disrupting peptide bonds and salt bridges amide bonds and alkene bonds hydrophobic interactions and peptide bonds Aluminum reacts with sulfuric acid. It produces a gas, and an aqueous solution. What mass (in g) of aluminum would completely react with...
4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This gene has only one exon meaning no sequence is spliced out during RNA processing. a) What will be the amino acid sequence this gene codes for? 15 points will be given for a completely correct amino acid sequence. You can get partial points if: the beginning of the amino acid sequence is correct (at least two first amino acids, 4 points), and/or the end...
You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you can't find it in one of your biology books). 14) What...
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
D Question 4 A silent mutation has no change in RNA sequence O no change to DNA, RNA, or protein O no change in protein sequence O no change in DNA sequence Question 5 Which mutation changes one amino acid for another? nonsense all of these are correct missense silent
Most questions answered within 3 hours.
-
Two particles with charges +4e and -7e are
initially very far apart (effectively an infinite distance...
asked 7 minutes ago -
Holding all else constant, when teams face a binding roster
limit, the salary of players is...
asked 11 minutes ago -
1. When can parametric and non-parametric statistical tests be
used?
A. Parametric?
The independent variable is...
asked 19 minutes ago -
How can bacteria resist killing from cationic antimicrobial
peptides (CAMPs)? Choose all that apply. a. Use...
asked 26 minutes ago -
As an economic term, what is the definition of :Technological
Trends? Please try and keep the...
asked 27 minutes ago -
Labor demand will be less elastic in those labor markets in
which:
A.
the price elasticity...
asked 28 minutes ago -
5 situations are listed below and 8 reduction chemicals are
listed A-H below, match the letters...
asked 34 minutes ago -
1. If more spouses decide to quit their jobs to stay home with
their young children...
asked 38 minutes ago -
Please use algebraic manipulation to prove the following
statement:
x'y'z' + x'yz' + x'yz + xyz'...
asked 38 minutes ago -
3.Another patient has a family history in which:
1. the disease was equally distributed among the...
asked 42 minutes ago -
If you are the TM of a shipper of cooking oil the sales
department wants to...
asked 40 minutes ago -
NEED THIS URGENTLY PLEASEEE
Suppose a fair coin is tossed 5 times and the result are...
asked 48 minutes ago