what is the significance of the start and stop codons in protein synthesis ?
what is the significance of the start and stop codons in protein synthesis ?
Homework Answers
While synthesizing a protein, start and stop codons are important because they instruct the cell machinery where to begin and end translation. The start and stop codons identify the location from where the mRNA translation must start and stop, respectively. In other words, it acts as a reference frame for transcription and prevent the UTRs from being translated.
The start codon marks the site at which translation into protein sequence begins, and the stop codon marks the site at which translation ends. At stop codon, the translation terminates.
Add Answer to:
what is the significance of the start and stop codons
in protein synthesis ?
What are the START and STOP codons of the COVID-19 S-protein? ATG and TGA ATG and...
What are the START and STOP codons of the COVID-19 S-protein? ATG and TGA ATG and TAG ATG and TAA
3. During translation, explain how the cell determines where to start and stop the protein synthesis...
3. During translation, explain how the cell determines where to start and stop the protein synthesis when an mRNA template is given
1. Summarize the main features or characteristics of the genetic code, including start & stop codons....
1. Summarize the main features or characteristics of the genetic code, including start & stop codons. 2. What is meant by base pair “wobble” and why might it be beneficial? 3. Describe the synthesis (and specificity) of aminoacyl-tRNA’s. 4. Name & describe the details in each of the three stages of protein synthesis, including the structure & functions of ribosomes and any factors involved. 5. Illustrate and/or describe the general structural, physical and/or chemical characteristics of amino acids. 6. Describe...
How do stop codons differ from other codons? (Check all that apply) stop codons can be...
How do stop codons differ from other codons? (Check all that apply) stop codons can be recognized by more than one tRNA stop codons code for only one amino acid stop codons bind to proteins stop codons are not part of the reading frame
Why can’t eukaryotic genes be used to express protein in bacteria? a. They lack stop codons...
Why can’t eukaryotic genes be used to express protein in bacteria? a. They lack stop codons b. They are too large c. They use different nucleic acids in their DNA d. They contain introns e. They cannot be replicated
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be...
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...
Chapter 15: 1. What is the significance of the fact that many synonymous codons differ in...
Chapter 15: 1. What is the significance of the fact that many synonymous codons differ in the third nucleotide position? 2. Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code C. Nonoverlapping code d. Initiation codon e. Termination codon f. Sense codon 8. Nonsense codon h. Universal code i. Nonuniversal code 3. What role do the initiation factors play in protein synthesis? 4. Compare and contrast the process of protein synthesis in...
How are stop codons recognized? -Proteins/Termination factors -lack of binding to A site -once the last...
How are stop codons recognized? -Proteins/Termination factors -lack of binding to A site -once the last amino acid is added to the protein -tRNAs that binds to stop codon
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
In a double-pass membrane protein, stop-transfer sequence signals termination of protein synthesis Select one: True False
In a double-pass membrane protein, stop-transfer sequence signals termination of protein synthesis Select one: True False
3. During translation, explain how the cell determines where to start and stop the protein synthesis when an mRNA template is given
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...
Chapter 15: 1. What is the significance of the fact that many synonymous codons differ in the third nucleotide position? 2. Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code C. Nonoverlapping code d. Initiation codon e. Termination codon f. Sense codon 8. Nonsense codon h. Universal code i. Nonuniversal code 3. What role do the initiation factors play in protein synthesis? 4. Compare and contrast the process of protein synthesis in...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
Most questions answered within 3 hours.
-
Write a program in python that lets the user play the game Rock,
Paper, Scissors against...
asked 8 minutes ago -
A car starts from rest on a curve with a radius of 150 m and
tangential...
asked 2 hours ago -
In Star Wars both the Storm Troopers and Droid Army are
notoriously bad shots. In order...
asked 6 hours ago -
when buffers react with h+ or oh-, do the ratio of conjugate
base to acid and...
asked 6 hours ago -
A population of values has a normal distribution with μ=207.3
and σ=35.8. A random sample of...
asked 6 hours ago -
An unknown solution was treated with H2SO4 and refluxed for 2
hours. The mixture was then...
asked 6 hours ago -
Let x be the age of a licensed driver in years. Let
y be the percentage...
asked 7 hours ago -
System.out.print( "Barrel\t"+"of"+"Laughs" );
asked 7 hours ago -
Need a 1,000 word self explanatory essay on how
characteristics of the functional, matrix & bureaucracy...
asked 7 hours ago -
(Could you explain how I can answer the question and what the
equation I will use)....
asked 7 hours ago -
The ΔGf0 values for HCO3- (aq),
CO32-(aq), and H+(aq) are -587.06,
-528.10 and 0 kJ mol-1,...
asked 8 hours ago -
Southeast Soda Pop, Inc., has a new
fruit drink for which it has high hopes. John...
asked 8 hours ago