Question

It looks like a hydrophobic pocket in mdm-2 interacts with several hydrophobic amino acids in 2. p53. What does hydrophobic

0 0
Add a comment Improve this question Transcribed image text
Answer #1

DO N- Ć-Ć-OH » Hydrophobic means :- Hydro - water phobic - fering It meens water fearing ie they lack polarity in their sideAlthough it has N-H in its side chain and it should be polar , but it is still non- polar & hydrophobic because Tryptophan a)

Add a comment
Know the answer?
Add Answer to:
It looks like a hydrophobic "pocket" in mdm-2 interacts with several hydrophobic amino acids in 2....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 2) On your first day working in my lab, you obtain the following DNA sequence: 3'...

    2) On your first day working in my lab, you obtain the following DNA sequence: 3' AATTATACACGATGAAGCTTGTGACAGGTTTCCAATCATTAA 5 5' TTAATATGTGCTACTTCGAACACTGTECCAAAGGTTAGTAATT 3' a) What are the two possible RNA molecules that could be transcribed from this DNA? Indicate the 5' and 3' ends of the RNA. b) Only one of these two RNA molecules can actually be translated. Explain why. c) It turns out that the RNA molecule that can be translated is the mRNA for p53. What is the amino...

  • Problems 1) Look at the structure of the natural amino acids (look them up). What do the 8 primordial amino acids have in common (generally)? What do you notice about the ones with 2 or fewer codons?...

    Problems 1) Look at the structure of the natural amino acids (look them up). What do the 8 primordial amino acids have in common (generally)? What do you notice about the ones with 2 or fewer codons? 2) Calculate the actual information content per amino acid of protein translation by using the genetic code and the fact that in nature, the frequency of U and C is 22%, A is 30% and G is 26%. Finally, since 3 of 64...

  • Question 1 (0.5 points) Saved Proteins are formed by joining together. carboxylic acids fatty acids amino...

    Question 1 (0.5 points) Saved Proteins are formed by joining together. carboxylic acids fatty acids amino acids none of the above Question 2 (0.5 points) Which two functional groups does an amino acid contain? amine and carboxylic acid carboxylic acid and amide amide and heterocyclic ring heterocyclic ring and amine Question 3 (0.5 points) Do amino acids commonly exist in nature as neutral molecules with all uncharged atoms? Yes No Question 1 (0.5 points) What is a protein? A polymer...

  • For what amino acid(s) does GCN code? Any of several amino acids, depending on the base...

    For what amino acid(s) does GCN code? Any of several amino acids, depending on the base represented by N Stop codons Lysine or arginine Alanine Case Study 12-2 A 7-month-old child suffered from sleep apnea and difficulty breathing. Respiratory infections and allergies were ruled out. From the family history, the physician suspected congenital congestive hypoventilation syndrome (CCHS). CCHS results, in part, from abnormal function of the PHOX2B gene product caused by a triplet-repeat expansion. The expansion of the triplet GCN...

  • 2. Silk contains the repeating sequence (Gly-Ser-Gly-Ala-Gly-Ala)n. This sequence is present in beta strands that interact...

    2. Silk contains the repeating sequence (Gly-Ser-Gly-Ala-Gly-Ala)n. This sequence is present in beta strands that interact with each other. Considering just a single strand within a sheet, the Ser and Ala side chains will be (on both sides of the sheet in a single repeat) (in first repeat, on one side; in the next repeat on the other side) (the answer depends on whether the strands are parallel or antiparallel) (on the same side of the sheet). 4. The figure...

  • 1. Why do ions like Na+ and Cl- tend to stick together? What kind of bond...

    1. Why do ions like Na+ and Cl- tend to stick together? What kind of bond results from this force? 2. Why do the nuclei of an oxygen atom and two hydrogen atoms remain close together in the structure of a water molecule? What is more stable about a molecule of H2O than three separate atoms of O, H, and H? 3.How is the force holding the water molecule together different from an ionic bond? 4. What makes the covalent...

  • ANSWER NEEDED TONIGHT. PLEASE DO ALL PARTS. I know it looks like a lot, but that's...

    ANSWER NEEDED TONIGHT. PLEASE DO ALL PARTS. I know it looks like a lot, but that's just because there's a lot of text. I need help on the "Anticipate" and "Do" sections; I can evaluate for myself. Please explain everything fully and in excruciating detail. Thank you! Note: When the problem asks what kind of "beast" something is, it mean to ask if it's a scalar or vector. 1. Projectile Over an Incline (modified from Taylor 1.39) A bal is...

  • 14.2 Modeling the Structure and Function of Nucleic Acids and Their Products 2. The following diagram...

    14.2 Modeling the Structure and Function of Nucleic Acids and Their Products 2. The following diagram represents some of the puzzle piece pieces used in this section. a Assembled in this form, do they represent an amino acid, c. a portion of messenger RNA, or a deoxyribonucleotide (b) Explain your answer. Opo 3. Why is DNA often called a double helix? 4. State the following ratios. (a) Guanine to cytosine in a double-stranded DNA molecule: (b) Adenine to thymine: -...

  • 1. Like phospholipids, lipopolysaccharides have a hydrophilic head and a hydrophobic tail. True or false 2....

    1. Like phospholipids, lipopolysaccharides have a hydrophilic head and a hydrophobic tail. True or false 2. The outer membrane of Gram negative bacteria contains lipopolysaccharides T or F 3. Biofilms and pure culture are formed by only one type of microorganism T or F 4. Any given antibiotic will have the same minimum inhibitory concentration (MIC) against any test microorganism. T or F 5. Production of antibiotics by the microorganism is not affected by the culture conditions T or F...

  • 11 Department of Biological Sciences BIOCHEMISTRY Test 2.2018 H. Nucleic Acid, Sequencing of DNA: Amino Acids...

    11 Department of Biological Sciences BIOCHEMISTRY Test 2.2018 H. Nucleic Acid, Sequencing of DNA: Amino Acids Hydrolysis of salt Laboratory buffers, Polyprotie acids QUESTIONS 1. The DNA strand complementary to the strand 3-GTAGCGTAT-Y' would have the sequence a SLTACOCATAT-3 b.3.CATOXICATA-S c. 3-ATGCGTATA-S" ATATGCGTAS 2. When cytosine is treated with bisulfite, the amino group is replaced with a carbonyl group. Identify the resulting base a. adenine b. guanine c uracil d. thyminee. typoxanthine 3. How many amino acids would be in...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT