Homework Answers
Add Answer to:
PART 2-1 point. What is the central dogma? DNA -2 Name the process: What catalyzes reaction?...
What is the sequence of information transfer, as outlined by the central dogma? 1) DNA-> tRNA->mRNA->...
What is the sequence of information transfer, as outlined by the central dogma? 1) DNA-> tRNA->mRNA-> polypeptide 2) DNA-> mRNA-> tRNA-> polypeptide 3) DNA-> mRNA-> rRNA-> polypeptide 4) polypeptide-> rRNA-> tRNA->DNA 5) polypeptide-> tRNA-> mRNA-> DNA
Name: 2. You cell cycle. Describe this process, including DNA replication (when is occurs and what is produced), The major portions of the cell cycle and what those portions are divided into. For...
Name: 2. You cell cycle. Describe this process, including DNA replication (when is occurs and what is produced), The major portions of the cell cycle and what those portions are divided into. For the cell division process you should use a chromosome number of 2N-4, instead of the real human chromosome number of 2N-46 have a broken leg and you realize that in order to heal your body needs to proceed through the
Name: 2. You cell cycle. Describe this...
1a. Which of the following DNA strands, the top or bottom, would serve as a template...
1a. Which of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction? 5′ ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3′ 3′ TGCCTGACATGGCGACTTCAGTACCTGCGAGCT 5′ ⎯⎯⎯⎯→ Direction of DNA unwinding b. What would be the resulting RNA sequence (written 5′→3′ )? 2. You have learned about the events surrounding DNA replication and the central dogma. Identify the steps associated with these processes that would be adversely affected in the...
DNA EXTRACTION AND THE CENTRAL DOGM 7. The two molecules that form the sides of the...
DNA EXTRACTION AND THE CENTRAL DOGM 7. The two molecules that form the sides of the 8. The chemical bonds joining complementary 9. The chemical bonds joining one nucleotide to ? DNA ladder another (sides of the ladder) B. REVIEW OF DNA REPLICATION: FILL IN 10. Cellular location of DNA replication in eukaryotes 11. Sites within DNA where replication begins 12. Method of DNA replication 13. DNA strand that is synthesized in a 0 continuous manner 14. Stage of the...
Name UNID Class 14 Central Dogma Capstone Worksheet Work together but each student must complete and...
Name UNID Class 14 Central Dogma Capstone Worksheet Work together but each student must complete and turn in their own worksheet. 1. In the sequence grid below, you will be guided through filling in all boxes with end label (polarity or directionality). nucleotide, or amino acid. This sequence is from the middle of a coding sequence, you do not need a start sequence Assume that this table is read from LEFT to RIGHT a. The column to the far left...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
1. Write an equation for the DNA replication reaction. List all the reactants and all the...
1. Write an equation for the DNA replication reaction. List all the reactants and all the products. (The equation does not need to be perfectly balanced.) 2. This diagram shows the process of DNA replication. Label the primers and DNA polymerases, and add two arrows to show the direction of movement of the DNA polymerases. Circle an area where helicase would be located. 3. A segment of a template DNA strand has the sequence shown below. Add the appropriate nucleotides...
You are given the following sequence of DNA which encodes for a short protein (this is...
You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...
Question 33 2 pts Which of the following statements about the process of DNA replication is...
Question 33 2 pts Which of the following statements about the process of DNA replication is true? It involves the enzyme DNA ligase, which corrects point mutations. It utilizes DNA polymerase, which catalyzes the reaction that adds a new nucleotide to the growing strand. The sequence on the new strand is always identical to one of the old parent strands. Adenine pairs with guanine, and cytosine pairs with thymine. Question 34 2 pts The DNA base...
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...
Name: 2. You cell cycle. Describe this process, including DNA replication (when is occurs and what is produced), The major portions of the cell cycle and what those portions are divided into. For the cell division process you should use a chromosome number of 2N-4, instead of the real human chromosome number of 2N-46 have a broken leg and you realize that in order to heal your body needs to proceed through the
Name: 2. You cell cycle. Describe this...
DNA EXTRACTION AND THE CENTRAL DOGM 7. The two molecules that form the sides of the 8. The chemical bonds joining complementary 9. The chemical bonds joining one nucleotide to ? DNA ladder another (sides of the ladder) B. REVIEW OF DNA REPLICATION: FILL IN 10. Cellular location of DNA replication in eukaryotes 11. Sites within DNA where replication begins 12. Method of DNA replication 13. DNA strand that is synthesized in a 0 continuous manner 14. Stage of the...
Name UNID Class 14 Central Dogma Capstone Worksheet Work together but each student must complete and turn in their own worksheet. 1. In the sequence grid below, you will be guided through filling in all boxes with end label (polarity or directionality). nucleotide, or amino acid. This sequence is from the middle of a coding sequence, you do not need a start sequence Assume that this table is read from LEFT to RIGHT a. The column to the far left...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
1. Write an equation for the DNA replication reaction. List all the reactants and all the products. (The equation does not need to be perfectly balanced.) 2. This diagram shows the process of DNA replication. Label the primers and DNA polymerases, and add two arrows to show the direction of movement of the DNA polymerases. Circle an area where helicase would be located. 3. A segment of a template DNA strand has the sequence shown below. Add the appropriate nucleotides...
You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...
Most questions answered within 3 hours.
-
1. What is the meaning of the term communication style?
2. What are the benefits to...
asked 12 minutes ago -
9.) You are buying a car that cost $26,500. You make payments of
$412 each month...
asked 36 minutes ago -
. Suppose a discrete random variable has probability
distribution
P(x) = .2 if x = 0...
asked 1 hour ago -
Problem #1
The area between Z = 0 and Z = 2.50
The area between Z...
asked 53 minutes ago -
Under the influence of its drive force, a snowmobile is moving
at a constant velocity along...
asked 2 hours ago -
Why do organizations decline? What steps can top
management take to halt, decline, and restore organizational...
asked 2 hours ago -
What mechanisms Drive speciation??
(I.e. what was Dawins theory on the orgin of species, and how...
asked 3 hours ago -
The manager at a car assembly plant believes that the mean
assembly time for a car...
asked 4 hours ago -
Which of the following is true of electron capture?
A) It decreases the nuclide's mass number...
asked 6 hours ago -
Assuming an efficiency of 43.10%, calculate the actual yield of
magnesium nitrate formed from 114.9 g...
asked 6 hours ago -
The highly pathogenic bacterium Clostridium
perfringens causes gangrene, a disease that results in the
destruction of...
asked 8 hours ago -
In the context of situation analysis, which of the following is
a category for analysis in...
asked 8 hours ago