Which of the DNA sequences below contain(s) a palindrome? Select as many as apply. Sequence 1:...
Which of the DNA sequences below contain(s) a palindrome? Select as many as apply.
Sequence 1: TTTTAAAA
Sequence 2: GGAATTCC
Sequence 3: GGAAGGAA
Sequence 4: GGAAAAGG
Homework Answers
Sequence 4 is a palindrome. GGAAAAGG
Palindromic sequence is a nucleotide sequence in DNA or RNA . Palindromic sequence contain a particular direction. In any palindromic sequence , the sequence remain same if we read it from the start side or the end side . Simple example of palindromic is 1551 . In sequence 4, GGAAAAGG is a palindrome. In case of double stranded DNA or RNA palindromic sequence means any one strand sequence reading in the same direction on the complementary strand.
Add Answer to:
Which of the DNA sequences below contain(s) a palindrome? Select
as many as apply.
Sequence 1:...
Question 8 1 pts (Select all Recombination signal sequences (RSS) that apply.) contain spacer sequences that...
Question 8 1 pts (Select all Recombination signal sequences (RSS) that apply.) contain spacer sequences that are either 7 or 9 base pairs in length contain conserved DNA sequences that are recognized by enzymes that facilitate the cutting and rejoining of gene segments ensure that the gene segments undergoing somatic recombination are joined in the correct order are located between the exons encoding the leader peptide and the V-region segments
Which of the following DNA sequences corresponds to the peptide sequence MSQHNEKNPH Select one or more:...
Which of the following DNA sequences corresponds to the peptide sequence MSQHNEKNPH Select one or more: a. atgtaacagcatccagaaaaaaagtattga O b. atgtcccaacatgataagaacttcaaccat □ catgagccaggcagttatagaaaaaccgcat datgagccagcataacgaaaaaaacccgcat
3. The partial gene (DNA) sequence below contains multiple PAM sequences. Highlight six PAM sequences in...
3. The partial gene (DNA) sequence below contains multiple PAM sequences. Highlight six PAM sequences in the top (5' to 3) strand. 5'-GCACGGCGGAGCGGTTCTTGGCAGCGGCCGCACGATCTCGTTGCCGCCGG- 3' 3-CGTGCCGCCTCGCCAAGAACCGTCGCCGGCGTGCTAGAGCAACGGCGGCC- 5' Once Cas9 binds to a PAM sequence, it unwinds the DNA. If the guide RNA matches the DNA sequence next to the PAM, the guide RNA will bind to the complementary DNA strand. If not, the DNA will zip back together and Cas9 will keep binding to other PAM sequences until it finds the...
How many different DNA sequences can be generated from a DNA sequence composed of 15 nucleotides...
How many different DNA sequences can be generated from a DNA sequence composed of 15 nucleotides (A, T, C or G)? How many different “biological information” can be produced from a protein sequence consisting of 15 amino acids?
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...
3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
Recombination signal sequences (RSSs) ______________________________. (Select all that apply.) Group of answer choices A.contain spacer sequences...
Recombination signal sequences (RSSs) ______________________________. (Select all that apply.) Group of answer choices A.contain spacer sequences that are either 7 or 9 base pairs in length B. are located between the exons encoding the leader peptide and the V-region segments C. contain conserved DNA sequences that are recognized by enzymes that facilitate the cutting and rejoining of gene segments D. ensure that the gene segments undergoing somatic recombination are joined in the correct order
Which of these sequences are convergent? (Select all that apply) (A) An= _cos (2n) 5" g"...
Which of these sequences are convergent? (Select all that apply) (A) An= _cos (2n) 5" g" (B) (n = 78 + 4 2n + (-1)"5 8n - (-1)"4 (D) «= (-2)" 2" + m3 (E) (n = 3 + 4" (F) (n = cos SAMSUNG
Which of the following is not true about noncoding DNA sequences? Choose one: A. They contain...
Which of the following is not true about noncoding DNA sequences? Choose one: A. They contain regulatory elements that ultimately dictate each organism’s development. B. They are essentially the same in humans, chimps, and mice. C. Their sequences have been shaped by evolution. D. Changes in these sequences are likely to be involved in giving rise to new species.
Which amino acid sequence would yield the most optimal oligonucleotide probe? How many sequences ...
Which amino acid sequence would yield the most optimal
oligonucleotide probe? How many sequences are possible for
each?
7) (10 points) Which amino acid sequence would yield the most optimal oligonucleotide probe? How many sequences are possible for each? Note: If two or more sequences both provide the most optimal probe, select both of them as the answer MICHAEL GAVRIEL CASSIEL
7) (10 points) Which amino acid sequence would yield the most optimal oligonucleotide probe? How many sequences are possible...
Question 8 1 pts (Select all Recombination signal sequences (RSS) that apply.) contain spacer sequences that are either 7 or 9 base pairs in length contain conserved DNA sequences that are recognized by enzymes that facilitate the cutting and rejoining of gene segments ensure that the gene segments undergoing somatic recombination are joined in the correct order are located between the exons encoding the leader peptide and the V-region segments
Which of the following DNA sequences corresponds to the peptide sequence MSQHNEKNPH Select one or more: a. atgtaacagcatccagaaaaaaagtattga O b. atgtcccaacatgataagaacttcaaccat □ catgagccaggcagttatagaaaaaccgcat datgagccagcataacgaaaaaaacccgcat
3. The partial gene (DNA) sequence below contains multiple PAM sequences. Highlight six PAM sequences in the top (5' to 3) strand. 5'-GCACGGCGGAGCGGTTCTTGGCAGCGGCCGCACGATCTCGTTGCCGCCGG- 3' 3-CGTGCCGCCTCGCCAAGAACCGTCGCCGGCGTGCTAGAGCAACGGCGGCC- 5' Once Cas9 binds to a PAM sequence, it unwinds the DNA. If the guide RNA matches the DNA sequence next to the PAM, the guide RNA will bind to the complementary DNA strand. If not, the DNA will zip back together and Cas9 will keep binding to other PAM sequences until it finds the...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
Which of these sequences are convergent? (Select all that apply) (A) An= _cos (2n) 5" g" (B) (n = 78 + 4 2n + (-1)"5 8n - (-1)"4 (D) «= (-2)" 2" + m3 (E) (n = 3 + 4" (F) (n = cos SAMSUNG
Which amino acid sequence would yield the most optimal
oligonucleotide probe? How many sequences are possible for
each?
7) (10 points) Which amino acid sequence would yield the most optimal oligonucleotide probe? How many sequences are possible for each? Note: If two or more sequences both provide the most optimal probe, select both of them as the answer MICHAEL GAVRIEL CASSIEL
7) (10 points) Which amino acid sequence would yield the most optimal oligonucleotide probe? How many sequences are possible...
Most questions answered within 3 hours.
-
Find the critical value(s) for the specified Wilcoxon
signed-rank test.
Sample size = 10, two-tailed test,...
asked 27 minutes ago -
why don't arctic animals feet freeze in winter biology
question
asked 10 minutes ago -
Cellular respiration in eukaryotes has the same purpose as
fermentation in prokaryotes
True
False
asked 11 minutes ago -
A random sample of size n = 32 is taken from a
population with mean μ...
asked 22 minutes ago -
Define the term myogenic index and describe how it is measured
experimentally. What cellular process can...
asked 14 minutes ago -
5.) (a) How does go-back-by N ARQ work?
(b) What operations are required for CRC error...
asked 24 minutes ago -
write a research report on the scope and potential of renewable
energy resources for the kingdom...
asked 23 minutes ago -
1) When the centers of two spherical masses are separated by
distance D, the masses exert...
asked 29 minutes ago -
Population Standard Deviation
5.0000
Sample Size
11
Sample Mean
54.9091
Confidence Interval
Confidence Coefficient
0.98
Lower...
asked 45 minutes ago -
Consider a t distribution with 15 degrees of freedom. Compute
P(-1.42<t<1.42). Round your answer to at...
asked 46 minutes ago -
2-chloro-2-methylpropane is classified as a ____.
primary alkyl chloride
secondary alkyl chloride
tertiary alkyl chloride
asked 44 minutes ago -
Help would be greatly appreciated
Mark each of the statements below as True (T) or False...
asked 46 minutes ago