Question

Question 25 3 pts Given the following DNA template, the sequence of the protein made is: 5-AGC TCG AAT TCG CTT CAT GCT AGC T


3 pts Question 30 In a cancer genomes database, you find multiple mutations in the BMV gene in several types of cancers. The
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Phiye Na Date genetic Code and AGC will code for serine amino acid in this will determines the serine amino acid lequence ofHence , option 5 is the correct answer .

30) Protooncogens are important for the growth of the cells . They are involved in the processes like DNA replication , repair of DNA , differentiation of a cell into a particular category. Oncogenes are formed from the protoncogens by certain mutations which leads to the the uncontrolled growth with very less or no differentiation. Oncogenes are also known as cancer genes. There are various reasons which leads to the conversion of protooncogens into oncogenes. The main factors is the mutations. Translocation and transposition of the DNA segment also leads to the development of oncogenes . Gene Amplification and point mutations results in the conversion of proto oncogenes into oncogens. Tumor suppressor genes are the genes which inhibits the production of cancer genes and regulates the growth and differentiation of the cells in the tissue. There , the mutant BMV gene is an oncogene.

Hence , option 1 is the correct answer .

The answer is further explained in diagram . Page No Date Oncogenes & Preosto-oncogenes [can care aceasing ] [ Gees Huidt stimulete mormal Cell- sell-growth # ConuertingThanking you

Have a beautiful day

Regards

Good luck ✨

Please Hit the thumbs up ??

Add a comment
Know the answer?
Add Answer to:
Question 25 3 pts Given the following DNA template, the sequence of the protein made is:...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • clon 25 3 p Given the following DNA template, the sequence of the protein made is:...

    clon 25 3 p Given the following DNA template, the sequence of the protein made is: 5'-AGC TCG AAT TCG CTT CAT GCT AGC TAG-----(+1)-------(-10)-------- --(-35 Leu-Ala-Cys-Met-Lys-Arg-lle-Arg-Ala Asp-Arg-Ser-Tyr-Phe-Ala-Stop Met-Ala-Ser-Stop Met-Lys-Arg.lle-Arg Ala Ser-Ser Asp-Ser-Leu-His-Ala-Ser-Stop

  • The next DNA sequence is the MATRICE strand of a small gene. What is the complete...

    The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...

  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on y...

    What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on your protein? Here is the vector: T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...

  • Incorrect Question 10 0/2 pts What will the polypeptide sequence be from the following DNA template...

    Incorrect Question 10 0/2 pts What will the polypeptide sequence be from the following DNA template strand? 3' CATGTACGCATTGAGAACTCGC 5' Asp-His-Ala-Stop-Leu-Leu-Ser Met-Arg-Asn-Ser Met-Arg-Asn-Ser-Ala Met-Tyr-Ala-Leu-Arg-Thr-Arg Asp-His-Ala-Leu-Leu-Ser Asp-His-Ala His-Val-Arg-Ile-Glu-Asn-Ser Met-Arg-Asn-Ser-Stop-Ala Check the orientation of the strands. How do you know which reading frame to use?

  • If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually...

    If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually changes the amino acid coded for, but changes to the 3rd "letter" rarely do, roughly what % of mutations should be synonymous? Second АТ G UUU Phe UCU Ser UAU Tyr UGU Cys U 0 C | Phe UCC Ser UAC Tyr UGC Cys C Leu UCA Ser UAA Stop UGA Stop UUG Leu UCG Ser UAG Stop UGG Trp G CUU Leu CCU...

  • please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A...

    please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...

  • Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein...

    Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291–300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-Tyr-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...

  • What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА...

    What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...

  • "A protein is made from a messenger RNA of the following sequence. What is the sequence...

    "A protein is made from a messenger RNA of the following sequence. What is the sequence of amino acids for this protein? (Remember, a start and a stop codon are needed for a protein to be made). 3' G C C G A U G G A U G A A G U U U U A A A G U A A U A G C A A U G G A G G A C 5'" (amino) met...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT