Homework Answers
Add Answer to:
IOL Below cartoon OI the Iinal stages OI translation polypeptide in a prokaryote. Arg Tyr Ser...
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala)...
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala) chou GU Tyrosine (Tyr) A с A Valine (Val) G U Cysteine (Cys) U G START HERE Typtophan (Trp) Arginine (Arg) A G U с A с Leucine (Leu) Serine (Ser) A с UGA Proline (Pro) Lysine (Lys) Asparagine (AST) Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon The anticodon for CCA is...
Question 12 What is the C-terminal amino acid residue in the following polypeptide? Met-Pro-Ser-His-Ile-Gly-Glu-Gln-Arg-Tyr
Question 12 What is the C-terminal amino acid residue in the following polypeptide? Met-Pro-Ser-His-Ile-Gly-Glu-Gln-Arg-Tyr
Place the following steps of TRANSLATION in the correct order for EUKARYOTES. The ribosome reaches a...
Place the following steps of TRANSLATION in the correct order for EUKARYOTES. The ribosome reaches a stop codon. A release factor binds and causes the release of the new polypeptide, along with the mRNA. The ribosome dissociates. v Acharged tRNA with a matching anticodon binds the mRNA codon in the A site. ✓ The ribosome moves exactly 3 nucleotides toward the 3* end of the mRNA. The small ribosomal subunit uses rRNA to bind to the Kozak sequence, which places...
Questionz 1 pts Put the steps of polypeptide chain elongation and termination in order (after the...
Questionz 1 pts Put the steps of polypeptide chain elongation and termination in order (after the initiation camnla bac formad [Choose ] Peptide bond formation between the polypeptide chain on the tRNA in the P site and the amino acid on the tRNA Translocation (the ribosome moves one codon toward the 3' end of the mRNA with the help of an elongation Step One ✓ The appropriate incoming aminoacyl-tRNA binds to an elongation factor bound to GTP The GTP is...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c....
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3' end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of...
Follow the instructions below to answer questions about Replication, Transcription & Translation. 3’- T A C...
Follow the instructions below to answer questions about
Replication, Transcription & Translation.
3’- T A C A
C C G G
T C A G
G T G A T C
-5’
A. Imagine that the sequence shown represents one strand of a
gene sequence. What would be the sequence of the complementary
strand of DNA? Write out your answer, indicating correct
polarity (5' and 3' ends) on your new strand. (1.5
points)
B. Now imagine that the new strand...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
Some amino acids are post-translationally removed from the C-terminal end of the beta-lactamase enzyme from B....
Some amino acids are post-translationally removed from the
C-terminal end of the beta-lactamase enzyme from B.
imaginarium (i.e. - after it is translated and
released from the ribosome, a protease chews off a some amino
acids). The wild-type enzyme, which has had the amino
acids removed from the C’-terminus, is 246 amino acids in length
and the C-terminal amino acids are shown below aligned with the
C-terminal amino acids of a frameshift mutant, which – due to a
frameshift mutation -...
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala) chou GU Tyrosine (Tyr) A с A Valine (Val) G U Cysteine (Cys) U G START HERE Typtophan (Trp) Arginine (Arg) A G U с A с Leucine (Leu) Serine (Ser) A с UGA Proline (Pro) Lysine (Lys) Asparagine (AST) Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon The anticodon for CCA is...
Question 12 What is the C-terminal amino acid residue in the following polypeptide? Met-Pro-Ser-His-Ile-Gly-Glu-Gln-Arg-Tyr
Place the following steps of TRANSLATION in the correct order for EUKARYOTES. The ribosome reaches a stop codon. A release factor binds and causes the release of the new polypeptide, along with the mRNA. The ribosome dissociates. v Acharged tRNA with a matching anticodon binds the mRNA codon in the A site. ✓ The ribosome moves exactly 3 nucleotides toward the 3* end of the mRNA. The small ribosomal subunit uses rRNA to bind to the Kozak sequence, which places...
Questionz 1 pts Put the steps of polypeptide chain elongation and termination in order (after the initiation camnla bac formad [Choose ] Peptide bond formation between the polypeptide chain on the tRNA in the P site and the amino acid on the tRNA Translocation (the ribosome moves one codon toward the 3' end of the mRNA with the help of an elongation Step One ✓ The appropriate incoming aminoacyl-tRNA binds to an elongation factor bound to GTP The GTP is...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
25. What binds to a stop codon on a mRNA during translation? a. transcription factor c. termination factor b. tRNA d. transcription initiator 26. What is typically attached to the acceptor end of a tRNA? a. a protein b. an amino acid C a ribosome d. a nucleosome 27. During mRNA processing, what is put on the 3' end of a primary mRNA transcript? a. a poly-A tail b. a cap d. an intron c. an exon 28. Which of...
Follow the instructions below to answer questions about
Replication, Transcription & Translation.
3’- T A C A
C C G G
T C A G
G T G A T C
-5’
A. Imagine that the sequence shown represents one strand of a
gene sequence. What would be the sequence of the complementary
strand of DNA? Write out your answer, indicating correct
polarity (5' and 3' ends) on your new strand. (1.5
points)
B. Now imagine that the new strand...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
Repo Fill in the needed bases, codon, anticodon, or amino acid needed to complete the following table that relates the sequences of DNA, mRNA, RNA, and the resulting polypeptide. DNA informational strand: 5' end 3' end Guide DNA template strand: 3' end GTC CCC GCG GGG ACG TTG 5' end mRNA codons: 5' end 5' end 0 0 3'end 3' end tRNA anticodons: Polypeptide: TABLE 22.3 The Genetic Code - Triplets in Messenger RNA First Base (5 end) Second Base...
Some amino acids are post-translationally removed from the
C-terminal end of the beta-lactamase enzyme from B.
imaginarium (i.e. - after it is translated and
released from the ribosome, a protease chews off a some amino
acids). The wild-type enzyme, which has had the amino
acids removed from the C’-terminus, is 246 amino acids in length
and the C-terminal amino acids are shown below aligned with the
C-terminal amino acids of a frameshift mutant, which – due to a
frameshift mutation -...
Most questions answered within 3 hours.
-
You are planning for retirement. You plan to work for 20 years.
Starting a year from...
asked 1 minute ago -
which of the following is capital?
the barn a farmer uses to hold the chickens he...
asked 3 minutes ago -
10. Two forces act on a 3 kg object, the gravitational force and
a second, constant...
asked 13 minutes ago -
Dividing Partnership Net Loss
Leigh Meadows and Byron Leef formed a partnership in which the
partnership...
asked 10 minutes ago -
Discuss how Entrepreneurial leadership style differs
from traditional leadership?
asked 36 minutes ago -
A futuristic design for a car is to have a large solid
disk-shaped flywheel within the...
asked 34 minutes ago -
Solid NaOH is added to a solution of 0.50 M acetic acid until
the pH of...
asked 37 minutes ago -
Which of the following statements is not a characteristic of the
Internal Revenue Code?
A) The...
asked 45 minutes ago -
Say true or false and explain it.
A heap is represented using an array. The array...
asked 55 minutes ago -
Explain how the DNA replication enzyme complex is organized and
functions, please don't copy paste from...
asked 54 minutes ago -
how
can personality contribute to one scoring high on the need to
evaluate measurement by Jarvis?
asked 56 minutes ago -
A high jumper is attempting to jump over a crossbar that is
placed at a height...
asked 1 hour ago