Question

the following is region of an eukaryotic mRNA:

5’-ACGCGCCUUCACACAGGAACAGCUAUGGCCAUGAGCACGCCAGUCUCGGCA

UUAUCCUAUUAAAGGGAACUGAGGUGA-3’

A.   Somewhere near the 5’ end is the Kozak consensus sequence. Using the given genetic code table, what would be the first 7 amino acid residues of this protein? Indicate polarity.

B.    How would the protein change due to the following mutation on the mRNA (be very specific and completewith your answers):

The deletion of nucleotide at position 22 (italicized)?

The G nucleotide at position 27 (italicized) is changed from a C?

The deletion of the nucleotide at position 31 (italicized)

Answer 1

Answer-

According to the given question-

Here we have a region of a eukaryotic mRNA-

5’ACGCGCCUUCACACAGGAACAGCUAUGGCCAUGAGCACGCCAGUCUCGGCAUUAUCCUAUUAAAGGGAACUGAGGUGA-3’

We know that DNA ---> RNA ----> Protein is called central dogma, Where the information present in DNA is transferred to mRNA in the form of codons, which later translated into Amino acid sequence by the process of translation.

mRNA sequence -

5’ACGCGCCUUCACACAGGAACAGCUAUGGCCAUGAGCACGCCAGUCUCGGCAUUAUCCUAUUAAAGGGAACUGAGGUGA-3’

A - Amino acid sequence - N -terminal- Met - Ala - Met - Ser - Thr - Pro - Val - Ser - Ala - Leu - Ser - Tyr -  C- terminal

first 7 amino acid residues of this protein will be- N -terminal- Met - Ala - Met - Ser - Thr - Pro - Val - C terminal

B.

(i) deletion of nucleotide at position 22 -

Normal mRNA sequence - 5’ACGCGCCUUCACACAGGAACAGCUAUGGCCAUGAGCACGCCAGUCUCGGCAUUAUCCUAUUAAAGGGAACUGAGGUGA-3’

Mutated mRNA sequence-

5’ACGCGCCUUCACACAGGAACACUAUGGCCAUGAGCACGCCAGUCUCGGCAUUAUCCUAUUAAAGGGAACUGAGGUGA-3’

Amino acid sequence - N -terminal- Met - Ala - Met - Ser - Thr - Pro - Val - Ser - Ala - Leu - Ser - Tyr -  C- terminal

Change in a nucleotide at the 22 positions,  is a type of point mutation, generally a deletion mutation, this does not cause any change in length of the Amino acid sequence and the length of the amino acid chain is the same as the original and native amino acid chain.

(ii) The G nucleotide at position 27 is changed from a C-

Normal mRNA sequence - 5’ACGCGCCUUCACACAGGAACAGCUAUGGCCAUGAGCACGCCAGUCUCGGCAUUAUCCUAUUAAAGGGAACUGAGGUGA-3’

Mutated mRNA sequence-

5’ACGCGCCUUCACACAGGAACAGCUAUCGCCAUGAGCACGCCAGUCUCGGCAUUAUCCUAUUAAAGGGAACUGAGGUGA-3’

Amino acid sequence - N -terminal- Met - Ser - Thr - Pro - Val - Ser - Ala - Leu - Ser - Tyr -  C- terminal

Change in a nucleotide at the 27 positions i.e. G is replaced by C, this is a type of point mutation, generally, a transversion, where the purine is replaced by pyrimidine nitrogenous base and vice-versa, this causes the change in length of the Amino acid sequence and the amino acid chain was have two amino acids less than the original and native amino acid chain. this causes the dysfunctional or less functional protein formation due to change in nucleotide.

(iii) The deletion of the nucleotide at position 31-

Normal mRNA sequence - 5’ACGCGCCUUCACACAGGAACAGCUAUGGCCAUGAGCACGCCAGUCUCGGCAUUAUCCUAUUAAAGGGAACUGAGGUGA-3’

Mutated mRNA sequence-

5’ACGCGCCUUCACACAGGAACAGCUAUGGCCUGAGCACGCCAGUCUCGGCAUUAUCCUAUUAAAGGGAACUGAGGUGA-3’

Amino acid sequence - N -terminal- Met - Ala - C- terminal

Change in a nucleotide at the 31 positions,  is a type of point mutation, generally a deletion mutation, this causes the change in length of the Amino acid sequence and the amino acid chain was have only two amino acid long than the original and native amino acid chain. this causes the dysfunctional or less functional protein formation due to change in nucleotide.