Question

A Gene has this sequence: GCATC TAC GCC ATG AAT AT. Translate all sequences in amino acids.

What would be the impact of these mutations on the protein? 1) GCATCTACGCGATGAATATT 2) GCATCTACGCCATCAATATT 3) GCATCTACGCCATG TATATT

Answer 1

The gene sequence is first transcribed into mRNA. The mRNA is complementary to the gene sequence. A, T, G and C of DNA is complementary to the U, A, C and G of mRNA. Then mRNA- codon chart is used to find the protein sequence.

Please look in the image for solution:

Gene sequence کی ТАС gcc GCATO ATG AAT ATT5 / slegung Aug cgg UAC UVA, VAAB mRNA Leu c N-met arg protein sequence ААТ АТГ 51 - tyr- Угсте ТАС Ясі АТЯ s' cguag Aug cgg YAÇ YUA, UVA UAA 3 mRNA - N - met -arg- tyr-Leu-c This is the case of silent mutation. Because protein sequence remains same even after mutation.

Ясс Атса ATT ATT5/ 29'ЯСА Тc TAC со 5' cguag Aug cgg UAG UUA UA A 31 mRNA - ATC TAC gcc Ата ТАТ is created. ATT5/ . N-met arg-c This is the case of non-scnse mutation. Because stop codon 3xc Ясс Ата cg UAG Aug cgg UAC QUA UA A 3 1) N-met-arg-etyr - ile - 5! MRNA

1) This is the case of silent mutation. Because protein sequence remains same even after mutation. The protein function remains same.

2) This is the case of non-sense mutation. Stop codon is produced after the mutation. The protein becomes non functional after the mutation.

3) This is the case of mis-sense mutation. Because single amino acid change occurs from leucine to isoleucine. There are found slightly change in the function of protein.

----

Please rate.