A Gene has this sequence: GCATC TAC GCC ATG AAT AT. Translate all sequences in amino...

Question

Question

A Gene has this sequence: GCATC TAC GCC ATG AAT AT. Translate all sequences in amino...

A Gene has this sequence: GCATC TAC GCC ATG AAT AT. Translate all sequences in amino acids.

What would be the impact of these mutations on the protein? 1) GCATCTACGCGATGAATATT 2) GCATCTACGCCATCAATATT 3) GCATCTACGCCATG TATATT

science biology

Add a comment Improve this question Transcribed image text

Answer 1

Answer #1

DATE: 3) GCATCT ACG CCA TOT ATA Alanine - Senine Thonine - proline - Cysteine Isoleucine-

Summary:--- The sequence of the amino acids sequence after mutations is shown in the image . Each amino acids is coded by 3 nucleotide sequence . The codon is readed in a continuous manner without any punctuations.

Thanking you

Have a beautiful day ?

Regards

Good luck ✨

Please Hit the thumbs up ??

Add a comment

Answer 2

Similar Homework Help Questions

A Gene has this sequence: GCATC TAC GCC ATG AAT AT. Translate all sequences in amino...

A Gene has this sequence: GCATC TAC GCC ATG AAT AT. Translate all sequences in amino acids. What would be the impact of these mutations on the protein? 1) GCATCTACGCGATGAATATT 2) GCATCTACGCCATCAATATT 3) GCATCTACGCCATG TATATT
a CCc GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT...

a CCc GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TOA 3 5'ATG GGG ONAS 2.4 Depict the mRNA transeript in the below e the mRNA
“translate” the following DNA nucleotide sequence into the amino acids that would be produced from this...

“translate” the following DNA nucleotide sequence into the amino acids that would be produced from this sequence. Hint 1 – DNA must first be transcribed into messenger RNA. Hint 2 – Your ANSWER will be written in amino acids not nucleotides! TAC AAT ACA ACT

15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...

15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
12. For each of the following sequences, fill in the mRNA sequence, the tRNA anticodons, and...

12. For each of the following sequences, fill in the mRNA sequence, the tRNA anticodons, and the amino acid sequences. DNA TAC CGC TCC GCC GTC GAC AAT ACC ACT AUG GLG mRNA tRNA AA DNA TAC TGA TCG ACC CCCATA ATG AAA ATC mRNA tRNA AA
5'-ATG-TCC-TCG-AAT-TTT-CCC-3' if a student induces a 2-nucleotide deletion to this sequence resulting in a frameshift mutation,...

5'-ATG-TCC-TCG-AAT-TTT-CCC-3' if a student induces a 2-nucleotide deletion to this sequence resulting in a frameshift mutation, changing the 3rd through 5th amino acids to Glu Phe Ser, what two nucleotides were deleted?

Examine the following nucleotide sequence from the sense strand of DNA. What is the amino acid...

Examine the following nucleotide sequence from the sense strand of DNA. What is the amino acid sequence of the encoded protein? (Show work) ATG - CCT - TAC - GCC - CCT - GGA - GAC - GAA - AAG - AAG - GGT
I have the answers to PART I, I need PART II please. PART I 1. Translate...

I have the answers to PART I, I need PART II please. PART I 1. Translate the following sequence: AUG GAG GUC UUU AAG AGA CAU UUA GAU GUA GCC CUU AGU GAU GUU UAG 2. Create one or more point mutations in this sequence: AUG GAG GUC UUU AAG AGA CAU UUA GAU GUA GCC CUU AGU GAU GUU UAG 3. Translate your mutated sequence. 4. Now, create a frameshift mutation by adding one or more bases. AUG GAG...
QUENCE al gene. Write in the mRNA sequence produced dur- the sequence of the amino acids...

QUENCE al gene. Write in the mRNA sequence produced dur- the sequence of the amino acids in the polypeptide produced ofMutation: Original Sequence. 2 3 4 5 6 7 DNA TAC GGC AGT CCT TCT GCA ACT mRNA mino AcIdS net Ho

I STARTED WRITING THE ANSWERS TO THIS PROBLEM. WE ARE TO COME UP WITH DNA SEQUENCES...

I STARTED WRITING THE ANSWERS TO THIS PROBLEM. WE ARE TO COME UP WITH DNA SEQUENCES FROM THE MRNA SEQUENCE. AM I GOING IN THE RIGHT DIRECTION WITH THE DNA SEQUENCES FOR THIS PROBLEM ? 1.The wildtype sequence of part of a protein is: NH2-Trp-Trp-Trp-Met-Arg-Glu-Trp-Thr-Met… Each mutant in the following table differs from wildtype by a single point mutation (base substitution). Using this information, determine the DNA sequence coding for the wildtype polypeptide. If there is more than one...

A Gene has this sequence: GCATC TAC GCC ATG AAT AT. Translate all sequences in amino...

Homework Answers

Add Answer to:
A Gene has this sequence: GCATC TAC GCC ATG AAT AT. Translate all sequences in amino...

Post as a guest

Earn Coins