Homework Answers
Request Answer!
We need at least 10 more requests to produce the answer.
0 / 10 have requested this problem solution
The more requests, the faster the answer.
Add Answer to:
Which type of mutation is likely to be more harmful? Substitution O Frameshift O Silent mutation...
Which mutation is most likely to have a severe impact on the phenotype of an organism...
Which mutation is most likely to have a severe impact on the phenotype of an organism if it occurs within the first several bases of a gene coding region? A) a frameshift mutation of three nucleotides B) a missense mutation affecting one nucleotide C) a missense mutation affecting three nucleotides D) a silent mutation affecting one nucleotide E) a frameshift mutation of one nucleotide
What type of physical mutation is least likely to affect gene function? A nonsense B missense...
What type of physical mutation is least likely to affect gene function? A nonsense B missense - nonsynomous C missense - synomous D silent E polymorphism F frameshift
*Hint: You will have one of each type. Types of Mutations? Point - Missense Frameshift -...
*Hint: You will have one of each type. Types of Mutations? Point - Missense Frameshift - Insertion Point - Nonsense Frameshift Deletion Point - Silent Original DNA Sequence: TACACCTTGGCGACT mRNA Sequence: AUG Amino Acid Sequence: Mutated DNA Sequence #1: TACATCTTGGCGACT What's the mRNA sequence? (Circle the change) AUG TALAALLA What will be the amino acid sequence? Will there likely be effects?_ What kind of mutation is this? Mutated DNA Sequence 12: TACGAC CTTGGCGACT What's the mRNA sequence? (Circle the change)...
Using these types of genetic changes: Base substitution, Transition, Transversion, Missense mutation, Nonsense mutation, Insertion, Deletion,...
Using these types of genetic changes: Base substitution, Transition, Transversion, Missense mutation, Nonsense mutation, Insertion, Deletion, Frameshift mutation Label these genetic changes (a-e). More than one answer may apply to each answer. a. GC->CG in the protein coding region on a gene. b. GC->TA in a GAA glutamate codon c. Loss of three bases GAA for a glutamate codon d. GC->CG in a tRNA gene e. GC->AT in the ribosome binding site of a mRNA
3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the...
3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the transcript: AUU UCU VUA GCA AGA GCU... Al The corresponding amino acids in the normal CFTR protein are: (Use either the one-or three-letter amino acid codes A naint mutation changes the last nucleotide from U to C. At the DNA level, this is a transition transversion c) At the protein level, this is a (silent / missense / nonsense/frameshift ) mutation. D) Instead of...
Q14 Homework. Unanswered What type of physical mutation would most likely occur as a result of...
Q14 Homework. Unanswered What type of physical mutation would most likely occur as a result of X-ray exposure? o A nonsense 0 B missense - nonsynomous o C missense - synomous o D silent O E polymorphism O F frameshift
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino aci...
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...
Which of the following mutations would be most likely to have a harmful effect on an...
Which of the following mutations would be most likely to have a harmful effect on an organism? (A) a deletion of three nucleotides near the middle of a gene (B) a single nucleotide deletion in the middle of an intron (C) a single nucleotide deletion near the end of the coding sequence (D) a single nucleotide insertion downstream of, and close to, the start of the coding sequence In this problem, why (c) cannot be the answer?? Single nucleotide deletion...
Q17 Homework – Unanswered What type of physical mutation would most likely occur as a result...
Q17 Homework – Unanswered What type of physical mutation would most likely occur as a result of exposure to Oxygen free-radicals? o A nonsense O B missense 0 C silent O D polymorphism O E frameshift
Please explain why,, for the second prob, why is it not missense mutation.. 20. The following...
Please explain why,,
for the second prob, why is it not missense mutation..
20. The following bit of the human RefSeq includes the entire first exon of a protein coding gene and part of the second exon 5'-AACTAACCACTGTCCGTACTCTGCCAGCCATCCGTAGC-3' 21. The canonical splice junctions are 5'-GU....AG-3', where ... indicates additional intronic sequence. Which of the following is a candidate for the protein-coding portion of the processed mRNA from this sequence? a. 5'-TACCGACCGTCTACCAATAAC-3' b. 5'-GCTACGGATGGCTGGCAGAGT-3' c. 5' -GUACGGACAGUGGUUAGUUCC-3' d. 5'-AUGGCUGGCAGAUGGUUAGUU-3' e. 5'-AACTAACCATCTGCCAGCCAT-3'...
*Hint: You will have one of each type. Types of Mutations? Point - Missense Frameshift - Insertion Point - Nonsense Frameshift Deletion Point - Silent Original DNA Sequence: TACACCTTGGCGACT mRNA Sequence: AUG Amino Acid Sequence: Mutated DNA Sequence #1: TACATCTTGGCGACT What's the mRNA sequence? (Circle the change) AUG TALAALLA What will be the amino acid sequence? Will there likely be effects?_ What kind of mutation is this? Mutated DNA Sequence 12: TACGAC CTTGGCGACT What's the mRNA sequence? (Circle the change)...
3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the transcript: AUU UCU VUA GCA AGA GCU... Al The corresponding amino acids in the normal CFTR protein are: (Use either the one-or three-letter amino acid codes A naint mutation changes the last nucleotide from U to C. At the DNA level, this is a transition transversion c) At the protein level, this is a (silent / missense / nonsense/frameshift ) mutation. D) Instead of...
Q14 Homework. Unanswered What type of physical mutation would most likely occur as a result of X-ray exposure? o A nonsense 0 B missense - nonsynomous o C missense - synomous o D silent O E polymorphism O F frameshift
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...
Q17 Homework – Unanswered What type of physical mutation would most likely occur as a result of exposure to Oxygen free-radicals? o A nonsense O B missense 0 C silent O D polymorphism O E frameshift
Please explain why,,
for the second prob, why is it not missense mutation..
20. The following bit of the human RefSeq includes the entire first exon of a protein coding gene and part of the second exon 5'-AACTAACCACTGTCCGTACTCTGCCAGCCATCCGTAGC-3' 21. The canonical splice junctions are 5'-GU....AG-3', where ... indicates additional intronic sequence. Which of the following is a candidate for the protein-coding portion of the processed mRNA from this sequence? a. 5'-TACCGACCGTCTACCAATAAC-3' b. 5'-GCTACGGATGGCTGGCAGAGT-3' c. 5' -GUACGGACAGUGGUUAGUUCC-3' d. 5'-AUGGCUGGCAGAUGGUUAGUU-3' e. 5'-AACTAACCATCTGCCAGCCAT-3'...
Most questions answered within 3 hours.
-
Cisco packet tracer
Q1) Do you get any changes of IP address when packet is
traversing...
asked 3 minutes ago -
What is the pressure inside a 33.0 L container holding 106.4 kg
of argon gas at...
asked 52 minutes ago -
Question no 2
A housekeeping support department budgets its costs at
SR 40,000 per month plus...
asked 49 minutes ago -
A 1400Kg sports car accelerates from rest to 90km/h in 7.0s.
What is the average power...
asked 1 hour ago -
For the following reaction, 0.128 moles of
potassium hydrogen sulfateare mixed with
0.504 moles of potassium...
asked 5 hours ago -
1. What is the present value of $400, three years in the future
if the interest...
asked 5 hours ago -
The labor force minus the number of employed equals the number
of unemployed.
a. True
b....
asked 7 hours ago -
Determine the mass in units of grams [g] of 0.49 moles [mol]
of a new fictitious...
asked 8 hours ago -
A horizontal mass of M=5kg is on a spring and stretched to
x=0.5m when released from...
asked 9 hours ago -
26 of 50
"I have worked at the Arizona Humane Society for ten years, and
have...
asked 9 hours ago -
Compare and contrast zero based budgeting and incremental (or
base year) budgeting.
asked 9 hours ago -
4 pts 10. Which of the following hypothesis would be MOST
difficult to test experimentally? Group...
asked 9 hours ago