ZuoTi.Pro
Question

QUESTION 1 Use the the sequence to answer the question below. 5- GGCGAUAUGGCGGUUUCGGGCCGGUGAAAUUGCCA-3 Based on the sequence
QUESTION 2 Transcription differ from translation in that transcription O reads off other RNA strands to make proteins. transl
QUESTION 3 Biofilms and mixed infections are examples of Synergism Mutualism O Parasitism Commensalism
QUESTION 4 Which of the following is/are TRUE? Select all TRUE statements. In mutualism species 1 benefits while species 2 is
science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

Question 1:
3’-CCGCTATACCGCCAAAGCCCGGCCACTTTAACGGT-5’ Template DNA (Antisense)
5’-GGC-GAU-AUG-GCG-GUU-UCG-GGC-CGG-UGA-AAU-UGC-CA-3’ mRNA
Met-Ala-Val-Ser-Gly-Arg
This sequence is in the right orientation or direction (5’-3’).
This sequence would code for 6 amino acids.
There is one stop codon (UGA).

Option 1 is wrong, because it starts with 5’.
Option 2 is wrong because though there are 11 codons, only 7 seven (6 coding + 1 stop codon) can be used.
Option 4 is wrong because there 35 bases.
Option 5 is wrong because this is an mRNA sequence (it has uracil).


Due to time constraint, I am unable to answer all the questions now. Kindly repost rest of the questions separately or mention “answer all the questions”. As per the HOMEWORKLIB RULES, I am only supposed to answer the 1st question (in case of multiple questions) or first 4 questions (in case of multiple subparts). If you have any specific doubts, I can answer in the comments.

0 0
Add a comment
Know the answer?
Add Answer to:
QUESTION 1 Use the the sequence to answer the question below. 5- GGCGAUAUGGCGGUUUCGGGCCGGUGAAAUUGCCA-3' Based on the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • QUESTION 2 Transcription differ from translation in that transcription reads off other RNA strands to make...

    QUESTION 2 Transcription differ from translation in that transcription reads off other RNA strands to make proteins. translates protein coding sequences. stores the genetic information needed to specify proteins. copies the genetic information required to specify one or more proteins. QUESTION 3 Biofilms and mixed infections are examples of Synergism Mutualism Parasitism Commensalism QUESTION 4 Which of the following is/are TRUE? Select all TRUE statements. In mutualism species 1 benefits while species 2 is not affected. Chemoautotrophs get energy from...

  • QUESTION 11 Meselson and Stahl had obtained the resuk below, what would have been there conclusion...

    QUESTION 11 Meselson and Stahl had obtained the resuk below, what would have been there conclusion First Generation Replication Replication N4 14 NINIS NAS N15 DNA replication is conservative DNA replication is semi-conservative DNA replication is dispersive None of the above QUESTION 12 If one strand of DNA Is CGGTAC in the 5-3 direction, what is the corresponding complementary strand of DNA in the 53' direction? GCCTAG ©GTACG TAACGT GCCATG CATGGA QUESTION 13 Which of the following statements regarding the...

  • 3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND...

    3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...

  • please answer all 4 questions Question 23 3 pts A plant that is homozygous recessive for...

    please answer all 4 questions Question 23 3 pts A plant that is homozygous recessive for mangled leaf and prickly fruit (mmpp) is crossed with the double heterozygote (MmPp), resulting in 1047 offspring: 472 with mangled leaves (mP), 453 with prickly fruit (Mp), 63 wild type (MP), and 59 with mangled leaves and prickly fruit (mp). From these data, you can conclude that o The M and P genes are located 11.7 CM apart o The M and P genes...

  • Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of...

    Assume that an E. coli cell translates the mRNA sequence (5)AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA(3') using the minimum number of tRNAs. If the mRNA sequence is translated into a fourteen amino acid peptide (starting at first 5 nucleotide), which of the following statements are true? Refer to the Codon Table and the table of "wobble rules" in the Hint. Gly, Glu, and Ser are repeated in the sequence and each uses multiple codons. Wobble rules allow Glu and Ser to use one tRNA each...

  • The genetic code is "redundant" because: Question 1 options: Each amino acid is specified by only...

    The genetic code is "redundant" because: Question 1 options: Each amino acid is specified by only a single codon Most amino acids are specified by multiple codons Codons are groups of four consecutive DNA bases Each codon can specify multiple amino acids Question 2 (1 point) A mutation in the DNA may not result in change in protein function because: Question 2 options: Many different amino acids share similar chemical properties, so can substitute for one another without altering function...

  • The genetic code is "redundant" because: Question 1 options: Each amino acid is specified by only...

    The genetic code is "redundant" because: Question 1 options: Each amino acid is specified by only a single codon Most amino acids are specified by multiple codons Codons are groups of four consecutive DNA bases Each codon can specify multiple amino acids Question 2 (1 point) A mutation in the DNA may not result in change in protein function because: Question 2 options: Many different amino acids share similar chemical properties, so can substitute for one another without altering function...

  • What are the three functional groups that comprise a nucleotide? What do nucleotides have in common...

    What are the three functional groups that comprise a nucleotide? What do nucleotides have in common with amino acids or simple sugars? When the structure of DNA was first elucidated, many biologists quickly saw how this structure explained the passage of information from one generation to another. How does the structure of DNA explain generation-to-generation flow of information? In other words, give a brief description of the structure of DNA and tell how this structure allows for replication. Which of...

  • 41) One codon for threonine i 5. ACU 3. The URNA molecule which threonine molecule will...

    41) One codon for threonine i 5. ACU 3. The URNA molecule which threonine molecule will have which sequence in its anticodon e ERNA molecule which furnishes the we a) 3' UGT 5' b) 3' UCA 5. c) 3' ACU 5. d) 3' UGA 5' e) 3' TGA 5 During the replication of DNA, the DNA base sequence S'AGCAT" original strand will generate which of the following sequences on strand? a) 5' ATCAG 3. b) 5 AGCAT 3. c) 5'...

  • 2 points Which of the statements below is false? * O The genetic code is universal....

    2 points Which of the statements below is false? * O The genetic code is universal. Degenerate codons specify the same amino acids. The genetic code is overlapping. O The genetic code is triplet. 2 points How many hydrogen bonds does cytosine form with guanine? * 2 3 O 4 2 points The amino acid sequence of a polypeptide chain comprises the structure of the protein. * primary secondary tertiary O quaternary 2 points One gene can have multiple effects...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT