Homework Answers
Complementary strand is the one strand of DNA which is formed by keeping the other as template. Since DNA is a double helix both are complement to each other.
In DNA ,A is paired with T and G with C
So the complement dna strand for TAGGCCTTA will be ATCCGGAAT .
Add Answer to:
Question 3 If a sequence of DNA IS TAGGCCTTA, what would be the sequence of its...
The following is a strand of DNA. What would be the sequence of the complimentary strand...
The following is a strand of DNA. What would be the sequence of the complimentary strand of DNA from this? 5'-CCGCATGTGTGAGATACA-3' Input your sequence starting at the 3' end, and ONLY type in the nucleotide sequence, with no other characters. Ex: AACCGAAC
If one strand of a DNA double helix has the nitrogen base sequence CGTACTG, what is...
If one strand of a DNA double helix has the nitrogen base sequence CGTACTG, what is the sequence of the DNA strand complimentary to this? O GCAUGAC OCTGCAGT O GACGUCA GTCATGA OGCATGAC
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Question 15 2 pts Given the DNA sequence 3 GTACG5' what is the sequence of the...
Question 15 2 pts Given the DNA sequence 3 GTACG5' what is the sequence of the complementary strand? Include the directionality! (the 3' and 5 on the ends so I know which direction the strand is going)
What would be the correct complimentary sequence for this sequence of nucleotides during DNA replication: 5’-AGGCGCA-3’?...
What would be the correct complimentary sequence for this sequence of nucleotides during DNA replication: 5’-AGGCGCA-3’? Select one: a. 3’-TCCGCGT-5’ b. 3’-UCCGCGU-5’ c. 5’-TCCGCGT-3’ d. 3’-AGGCGCA-5’ e. 5’-UCCGCGU-3’
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1)...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1) b. Identify the promoter region using the original strand. (1) c. Circle the start codon and stop codon using the original strand. (2) d. Construct the mRNA transcript. (1) e. List the amino acids produced by this sequence. (2) f. Determine the palindromic sequence of the EcoRI restriction endonuclease that recognizes the GAATTC sequence. (1) g. Would the EcoRI restriction enzyme be useful when...
What is the nucleotide order of the conplimentary mRNA? What sequence of amino acids is coded...
What is the nucleotide order of the conplimentary mRNA? What
sequence of amino acids is coded by the DNA?
Question 1. For the following questions, use the genetic code in table 18.1. A DNA strand consists of 3'-TCAATACCCGCG-5'. What is the nucleotide order of the complimentary mRNA? What sequence of amino acids is coded by the DNA?
If a template DNA strand has the base sequence 3'-GTC...CCA-5, what would be the sequence of...
If a template DNA strand has the base sequence 3'-GTC...CCA-5, what would be the sequence of the corresponding mRNA? (Note: "..." represents an intervening sequence) a. 3 CAG...GGU S' b. 5'CAG.GGU-3 OCCAGGGT-3 O d. 5'-GUC...CCA-5 Oe.3GUC...CCAS'
Question 2 1 pts A sequence of DNA that contains information for the synthesis of RNA...
Question 2 1 pts A sequence of DNA that contains information for the synthesis of RNA molecules used in the manufacture of proteins is also known as a(n) intron. mutation. gene. codon. Flag this Question Question 3 1 pts A small segment of DNA on the template strand contains the base sequence CGT. If an mRNA transcript is made that includes this sequence, what would be the anticodon on the tRNA that would bind to this corresponding mRNA sequence? CGT...
If the sequence of one strand of DNA is 5' ATGCAGGCTGATCCGACGAAG 3', what is the sequence...
If the sequence of one strand of DNA is 5' ATGCAGGCTGATCCGACGAAG 3', what is the sequence of the complementary stand?
The following is a strand of DNA. What would be the sequence of the complimentary strand of DNA from this? 5'-CCGCATGTGTGAGATACA-3' Input your sequence starting at the 3' end, and ONLY type in the nucleotide sequence, with no other characters. Ex: AACCGAAC
If one strand of a DNA double helix has the nitrogen base sequence CGTACTG, what is the sequence of the DNA strand complimentary to this? O GCAUGAC OCTGCAGT O GACGUCA GTCATGA OGCATGAC
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Question 15 2 pts Given the DNA sequence 3 GTACG5' what is the sequence of the complementary strand? Include the directionality! (the 3' and 5 on the ends so I know which direction the strand is going)
What is the nucleotide order of the conplimentary mRNA? What
sequence of amino acids is coded by the DNA?
Question 1. For the following questions, use the genetic code in table 18.1. A DNA strand consists of 3'-TCAATACCCGCG-5'. What is the nucleotide order of the complimentary mRNA? What sequence of amino acids is coded by the DNA?
If a template DNA strand has the base sequence 3'-GTC...CCA-5, what would be the sequence of the corresponding mRNA? (Note: "..." represents an intervening sequence) a. 3 CAG...GGU S' b. 5'CAG.GGU-3 OCCAGGGT-3 O d. 5'-GUC...CCA-5 Oe.3GUC...CCAS'
Most questions answered within 3 hours.
-
Please explain how participation income and expenses are
allocated to each partner. Where is this defined?
asked 13 seconds ago -
The tires of a car make 61 revolutions as the car reduces its
speed uniformly from...
asked 15 minutes ago -
Peabody, Inc., sells fireworks. The company’s marketing director
developed the following cost of goods sold budget...
asked 20 minutes ago -
A signal transduction pathway includes the steps listed
below.
1. An inactive signal transduction molecule is...
asked 19 minutes ago -
1. The correlation coefficient determined for two variables has
a value of 0.89. Describe, in words,...
asked 25 minutes ago -
The following data relate to direct materials costs for
November:
Actual costs
4,700 pounds at $5.35...
asked 23 minutes ago -
Kyle, a 95.0 kg football player, leaps straight up into the air
(with no horizontal velocity)...
asked 47 minutes ago -
Which of the following is a measure of profitability?
A.
Quick (acid-test) ratio
B.
Net sales...
asked 50 minutes ago -
Find the total pressure exerted by 2 grams of ethane and 3 grams
of CO2 contained...
asked 51 minutes ago -
A fireman standing on a 5.2 m high ladder operates a water hose
with a round...
asked 47 minutes ago -
A cream formulation is studied for accelerated stability study.
Creaming was observed when formulation was tested...
asked 50 minutes ago -
A 1,150 lumen light bulb is placed 37 cm in front of a mirrored
wall, whose...
asked 1 hour ago