Question 2 1 pts
A sequence of DNA that contains information for the synthesis of RNA molecules used in the manufacture of proteins is also known as a(n)
intron.
mutation.
gene.
codon.
Flag this Question
Question 3 1 pts
A small segment of DNA on the template strand contains the base sequence CGT. If an mRNA transcript is made that includes this sequence, what would be the anticodon on the tRNA that would bind to this corresponding mRNA sequence?
CGT
GCA
CGU
GCT
Answer. 21. Option C is the correct answer.
Explanations:- A sequence of DNA that contains information for the synthesis of RNA molecules used in the manufacture of proteins is also known as a gene. A gene is thus the functional component of DNA that is responsible for a functional protein. A particular protein is formed from a particular gene. So each protein is coded by different gene. Our body or cells contains a large number of gene.
Answer. 31. Option C is the correct answer.
Explanations:- It is the process of central dogma. In central dogma, the DNA is first converted into mRNA by the the process of the transcription. Then the mRNA is converted into functional protein by the process called as the translation. In translation process the codon of the mRNA is matched with the anti codon of the tRNA . In the tRNA , the base pairs are matched as following, A will pair with U, C will pair with G and vice versa. So the anticodon sequence will be CGU.
Question 2 1 pts A sequence of DNA that contains information for the synthesis of RNA...
1.) In which direction is RNA transcribed? 2.) Which of the two strands (A or B) serves as the TEMPLATE strand for the transcription of a mRNA that contains both a start and a stop codon? 3.) Which number (1, 2, 3, 4, or 5) best approximates the location of the -10 consensus sequence? 4.) How many amino acids long is the protein encoded by the mRNA from this DNA sequence? 5.) What is the second...
2. For the following short segment of a DNA strand, complete the following table. The codon dictionary is provided for you on the previous page. Translation and the Genetic Code: mRNA Codons 1. Define the following terms and whether they exist in DNA or RNA. Term DNA or RNA? Gene Definition Codon 2. For the following short segment of a DNA strand, complete the following table. The codon dictionary is provided for you on the previous page Coding DNA sequence:...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
Update Some availab Question 13 0.5 pts Use this DNA strand for the following question. (The hydrogen bonds have been broken in this region of the DNA molecule and the strands have separated.) TACGTACCGTAGGAT The mRNA that you made in the previous questions has (a) codons. (number-use numerals, not spelling) Question 14 0.5 pts The sequence of the first codon is [a]. (Use information from the previous questions.) Question 15 0.5 pts The sequence of the anticodon of the first...
QUESTION 6 The DNA sense (coding) strand for a particular amino acid is 5'-CAT-3'. What RNA sequence would be transcribed for this codon, what tRNA anticodon would recognize it, and what amino acid would be added in response to this codon? O 5'-UUU-3' (RNA sense); 3'-AAA-5' (tRNA anticodon); phenylalanine O 5'-CAU-3' (RNA sense); 3'-GUA-5' (tRNA anticodon); histidine O 5'-CAU-3' (RNA sense); 3'-AUG-5’ (tRNA anticodon); tyrosine O 3'-AUG-5' (RNA sense); 3'-UAC-5' (TRNA anticodon); valine QUESTION 7 The “wobble” base is less...
0/5 pts Incorrect Question 15 The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3CATGGACAGgtaagaatacaacacagGTCGGCATGACG5 GUACCUGU cauuuuauguuguguCCAGCCGUACUGC What would be...
1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The point mutation in the gene results in the MRNA sequence AUGCCGGACUUU. What are the amino acid sequence for the normal and mutant proteins? Say, with an explanation whether you expect this to be a silent mutation. b. Why is DNA polymerase said to be template-directed? If a RNA had the nucleotide sequence 5'-AUGCCAUAACGAUACCCCAGUC-3', what was the sequence of the DNA strand that was transcribed...
My gradesSupportThis course 88 GBIO106_91NT stion 1 For tRNA to function in protein production, it must bind to both a and an yet answered Select one a gene, amno acid b.gene, anticodon Flag question codon, amino acid d codon, anticodon estion 2 ot yet anwered In transcription f100 Select one a a promotes sequence Y Flag question b DNA produces messenger RNA c several RNA molecules are made from the same DNA molecule d all of the above