Question

& Genetic Mutations X 2. Lab12. eScience Transcription X + Chapter 13.2 х /sites/default/files/V3/Biology/2nd_Edition General

Need some help with an exercise in my biology course.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

1. Met Glu Val Phe Lys Arg His Leu Asp Val Ala Val Ser Asp Val Stop

2. Point mutations: AUG GUG GUC UUU AGG AGA CAU UGA GAU GUA GCC CUU AUU GAU GUU UAG

3. Met Val Val Phe Arg Arg Hist Stop

4. AUG GAC(1) GGU CUU UAA GAG ACA UUU AGG(2) AUG UAG CCC UUA GUG AUG UUU AG

5. Met ASsp Gly Leu Stop

6. AUG GAG GU(1)U UUA AGA GAC AUU UAG AUG UAG CCC UUA GUG AUG UUU AG

7. Met Glu Val Leu Arg Asp Ile Stop

8. Met Glu Val Phe Lys Arg His Leu Asp Val Ala Val Ser Asp Val Stop

Met Val Val Phe Arg Arg Hist Stop

Met ASsp Gly Leu Stop

Met Glu Val Leu Arg Asp Ile Stop

Add a comment
Know the answer?
Add Answer to:
Need some help with an exercise in my biology course. & Genetic Mutations X 2. Lab12....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • I have the answers to PART I, I need PART II please. PART I 1. Translate...

    I have the answers to PART I, I need PART II please. PART I 1. Translate the following sequence: AUG GAG GUC UUU AAG AGA CAU UUA GAU GUA GCC CUU AGU GAU GUU UAG 2. Create one or more point mutations in this sequence: AUG GAG GUC UUU AAG AGA CAU UUA GAU GUA GCC CUU AGU GAU GUU UAG 3. Translate your mutated sequence. 4. Now, create a frameshift mutation by adding one or more bases. AUG GAG...

  • Use the genetic code table to answer the following question: Second Base First Base Third Base...

    Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...

  • Bring this DNA sequence to protein using the transcription (3pts) and translation (4 pts) processes. note:...

    Bring this DNA sequence to protein using the transcription (3pts) and translation (4 pts) processes. note: Pending the direction your DNA is located Second position UUU Ae UCU UCC cys DU Sey UAU UAC UAA UAG UGU UGC UGA UGG UUA tyr Stop Stop JC Stop CUU CUC his CUA 5 'ATGCCGACGCCATAA 3' Lleve esta secuencia de ADN hasta proteína mediante los procesos de transcripción (3pts) y traducción (4 pts). First position (5'-end) CUC AUU AUC ile AUA AUG met...

  • 1. You are a scientist studying a rare heritable disease, Pitt-Hopkins syndrome. This disease is caused...

    1. You are a scientist studying a rare heritable disease, Pitt-Hopkins syndrome. This disease is caused by mutations in the basic helix-loop-helix transcription factor, TCF4. You sequence the TCF4 gene in your patients and identify several sequence variants. a) The TCF4 coding region and sites of mutations for several patients are shown here (lines between codons indicate the open reading frame). For each patient, identify the impact of the mutation on the coding sequence (1 mark each) and the likely...

  • A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3'...

    A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...

  • 7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first...

    7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first four amino acids that this sequence codes for? (Not that the coding strand has been labeled). 5'-TACTTCTGGCATATC-3' 3'-ATGAAGACCGTATAG-5' (coding) Second letter C AG UUU Phe UCU) UAU Tyrac Cys UUCS Ser UUG UACJ'Y UAA Stop UGA Stop UAG Stop UGG Trp CGU CAC) CGC CGA CGG CAU-His CUU CUC Leu CUA CUG J Pro CAAG CAGGI First letter DUO DOCUDUCUDUCU Third letter ACU AAU...

  • (Molecular Biology) 15 A , B , C second position UCU UAU Tyr UGU UGC UAC...

    (Molecular Biology) 15 A , B , C second position UCU UAU Tyr UGU UGC UAC UUU Phe UUC UUA UUGLE Ser UAA UGA stop stop UAG CCU CUU CUC CAU CAC His ССС CGU CGC Leu Pro CUA CAA CUG CCG CAG Gin CGG first position third position AAU AUU AUC Asn lle AAC ACU ACC ACA ACG Thr AGU AGC AGA AGG AUA AAA AUG Met AAG Lys GUU GCU Asp GAU GAC GAA GGU GGC Val GUC...

  • Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...

    Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...

  • 10. (20 points) Which of the restriction nucleases listed below can potentially cleave a segment of...

    10. (20 points) Which of the restriction nucleases listed below can potentially cleave a segment of cDNA that encodes the peptide KIGDACF? You must show your work. The Genetic Code с Т А Т UUU Phe (F) UCU Ser (S) UAU Tyr ( Y UGU Cys (C) UUC - UCC UAC. UGC. UUA Leu (L) UCA UAA Stop UGA Stop UUG- UCG UAG Stop UGG Trp (W) CUU Lệu U CCU Pro (P) CAU His (H) CGU Arg (R) CUC...

  • The next DNA sequence is the MATRICE strand of a small gene. What is the complete...

    The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT