Please place your answer on the form, thanks Assignment 4 Here is a straightened DNA double...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
I have my own answers, i just want to check my work, thanks! Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?
1. Label the template and coding strand. Label upstream and downstream ends.2. On the template strand identify the promoter.3. Identify the start site.4. Block off and number the triplets to be transcribed.5. Create the pre-mRNA. Label 5’ and 3’ ends.6. Using the codon table for mRNA (genetic dictionary), identify the start and stop codons.7. Identify the utrs (untranslated regions).8. Add a 5’ cap to the 5’ end of the mRNA transcript and a poly-A-tail to the 3’ end.9. Block off...
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.
1) Using the bacterial DNA sequence that the instructor gave you:a. Identify and underline the promoter region and the start codon.b. Identify the coding and template strandc. Transcribe the coding sequenced. Translate the mRNA sequence8) Which of the following mutational changes would you predict to be the most deleterious to gene function? Explain your answers.a. Insertion of a single nucleotide near the end of the coding sequence.b. Removal of a single nucleotide near the beginning of the coding sequence.c. Deletion...
The following is a fragment of double-stranded DNA. It encodes a hypothetical 6 amino acid protein and includes the start (initiator) codon, a small amount of 5' UTR, and a small amount of 3' UTR. TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA The bottom strand is the template, and the RNA polymerase moves along the bottom (template) strand from RIGHT TO LEFT. a) Determine the orientation of the DNA template. The template strand is copied below. (Enter either 5' or 3' in the box below,...
5. Hemoglobin is the protein found in red blood cells that transports oxygen from your lungs to your cells. Below is a segment of the DNA sequence that codes for a normal hemoglobin protein (the entire gene is much longer). Using the DNA sequence provided, transcribe the sequence into mRNA. Use the bottom strand as the coding strand. 5' ACTGCCCATGGTGCAC CIGACTCCTGAGGAG 3' 3' TGAC GG GIACCA CGT GGA CIGAG GACTCCTC 5 6. For hemoglobin, translate the mRNA strand from step...
hi please help. im having trouble with transcribing the given dna fragment! 1. A double stranded DNA has the following sequence: +1 5' GGCGGCGGCTGCCTATGCTGGCTTCAGCGTAGGCGTAC 3' coding strand TIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 3' CCGCCGCCGACGGATACGACCGAAGTCGCATCCGCATG 5' A UUU UAUTY ser UCO Stog Transcribe the given DNA fragment (5-GGC GGA UGC CUC GGC UGG CUU AAG CGG AC 5'UTR (highlight in green) Second Letter с 3' UTR (highlight in blue Start Codon (highlight in yellow) VUC ) Stop Codon (highlight in red) Open reading frame (enter...