Question

1. What is the purpose of the promoter reg E. coli and in eukaryotes. (2.5 points each, total of 5 points) e or the promoter
0 0
Add a comment Improve this question Transcribed image text
Answer #1

real celle Purpose of promate initiated Promato of expression ponent of Promater Region - A prometer is a region of DNA wher

Add a comment
Know the answer?
Add Answer to:
1. What is the purpose of the promoter reg E. coli and in eukaryotes. (2.5 points...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 1. Describe the three stages in transcription in prokaryotes and note the functions of the enzymes...

    1. Describe the three stages in transcription in prokaryotes and note the functions of the enzymes that are involved for each. 2. Describe three ways in which transcription in in eukaryotes is different from that of prokaryotes. 3. At what stage of transcription do these alterations take place in? Initiation, Elongation or Termination? 4. Draw a prokaryotic gene with the following features: a. A promoter region with -35 and -10 consensus sequences. b. The start point of transcription with first...

  • Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work...

    Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...

  • QUESTION 1 In E. coll, what two promoter regions are recognized by the s70 subunit? the...

    QUESTION 1 In E. coll, what two promoter regions are recognized by the s70 subunit? the -10 and 35 regions the - 10 region and the Pribnow box the-10 and -70 regions the-35 and -70 regions QUESTION 2 Which protein must first bind to the origin of replication for DNA synthesis to begin? DNA polymerase DnaA helicase Single-strand binding protein Click Save and Submit to save and submit. Click Save All Answers to save all answers. 2 Ch 16 PPT...

  • ARE MY ANSWERS CORRECT? 25 questions 1. what an A/R aging analysis is, its purpose, and...

    ARE MY ANSWERS CORRECT? 25 questions 1. what an A/R aging analysis is, its purpose, and how it is created. Used to estimate amount needed in Allowance for Bad Debts Account (a contra account) A/R Days Outstanding 0-30           31-60               61-90               Over 90 Under each term list all A/Rs that are not paid by date Use historical experience to estimate the percentage of A/R for each date period to determine allowance for Bad Debts What the three major cost components are...

  • Multiple-Choice Questions (worth two points each) 1. Which of the following describes the process in which...

    Multiple-Choice Questions (worth two points each) 1. Which of the following describes the process in which one adopts patterns of behavior that lead to greater life satisfaction? A. wellness B. health C. social determination D. self-efficacy 2. The Stages of Change Model of health behavior change emphasizes that A. change happens as a process. B. people change only when faced with an illness. C. change occurs only when the environment supports it. D. changes are more effective when based on...

  • I need Summary of this Paper i dont need long summary i need What methodology they used , what is the purpose of this p...

    I need Summary of this Paper i dont need long summary i need What methodology they used , what is the purpose of this paper and some conclusions and contributes of this paper. I need this for my Finishing Project so i need this ASAP please ( IN 1-2-3 HOURS PLEASE !!!) Budgetary Policy and Economic Growth Errol D'Souza The share of capital expenditures in government expenditures has been slipping and the tax reforms have not yet improved the income...

  • 1. According to the paper, what does lactate dehydrogenase (LDH) do and what does it allow...

    1. According to the paper, what does lactate dehydrogenase (LDH) do and what does it allow to happen within the myofiber? (5 points) 2. According to the paper, what is the major disadvantage of relying on glycolysis during high-intensity exercise? (5 points) 3. Using Figure 1 in the paper, briefly describe the different sources of ATP production at 50% versus 90% AND explain whether you believe this depiction of ATP production applies to a Type IIX myofiber in a human....

  • Discussion questions 1. What is the link between internal marketing and service quality in the ai...

    Discussion questions 1. What is the link between internal marketing and service quality in the airline industry? 2. What internal marketing programmes could British Airways put into place to avoid further internal unrest? What potential is there to extend auch programmes to external partners? 3. What challenges may BA face in implementing an internal marketing programme to deliver value to its customers? (1981)ǐn the context ofbank marketing ths theme has bon pururd by other, nashri oriented towards the identification of...

  • SYNOPSIS The product manager for coffee development at Kraft Canada must decide whether to introduce the...

    SYNOPSIS The product manager for coffee development at Kraft Canada must decide whether to introduce the company's new line of single-serve coffee pods or to await results from the product's launch in the United States. Key strategic decisions include choosing the target market to focus on and determining the value proposition to emphasize. Important questions are also raised in regard to how the new product should be branded, the flavors to offer, whether Kraft should use traditional distribution channels or...

  • How can we assess whether a project is a success or a failure? This case presents...

    How can we assess whether a project is a success or a failure? This case presents two phases of a large business transformation project involving the implementation of an ERP system with the aim of creating an integrated company. The case illustrates some of the challenges associated with integration. It also presents the obstacles facing companies that undertake projects involving large information technology projects. Bombardier and Its Environment Joseph-Armand Bombardier was 15 years old when he built his first snowmobile...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT