Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then translated...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
The process of making RNA using DNA as a template is called ___. The process of using the codes in RNA to make protein is called ___. Complete the following table with information on the three types of RNA polymerases and role of specific type of RNA in protein synthesis: In prokaryotes, the two stages of protein synthesis are: ___ and ___. In eukaryotes, the three stages of protein synthesis are ___, ___ and ___. During transcription, a ___ ___...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
3. Below is the template DNA sequence for a short human protein: Template DNA = 3’ GCATGACTATTAATACGTGCGCTACCAGACTTGA5’ A. How many amino acids will the protein translated from this mRNA have? B. How many nucleotides in total will be transcribed but not translated? Assume that the stop codon is not part of the untranslated region.
1.) In which direction is RNA transcribed? 2.) Which of the two strands (A or B) serves as the TEMPLATE strand for the transcription of a mRNA that contains both a start and a stop codon? 3.) Which number (1, 2, 3, 4, or 5) best approximates the location of the -10 consensus sequence? 4.) How many amino acids long is the protein encoded by the mRNA from this DNA sequence? 5.) What is the second...
During elongation of proteins during protein synthesis tRNA with the amino acid that matches its anticodon binds to the codon on the mRNA. each new amino acid is first transferred to the anticodon of the tRNA. anticodons on the ribosomes recognize the codons on the mRNA and attach the correct amino acids. ribosomes move along the DNA. RNA polymerase II uses the codons on the mRNA to polymerize the protein.
where does transcription begin 3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...
Lab #14 Protein Synthesis Introduction Proteins are vital for the survival of an organism. Proteins make enzymes and hormones which control reactions that must take place in the cell to survive.Proteins are made of basic units called amino acids. There are a total of 20 amino acids. Different proteins have different number and/or combination of amino acids. The kind of amino acid that is used when producing the protein depends on the 3-base code (codon) read from the RNA molecule...
10. With regard to transcription, the enzyme begins of a DNA transcribing RNA after it attaches to the molecule. With regard to translation, the begins translating a polypeptide after it attaches to the __ of an mRNA molecule. Start and stop codons are involved in the process of The start codon is , while the stop codons are 11. and Does the start codon specify an amino acid? If so, which one(s)? Do the stop codons specify an amino acid?...