A sample of DNA was sequenced using the dideoxy nucleotide method, and the resulting (synthesized) products were resolved on the gel (shown here). What is the correct sequence of the synthesized DNA (=DNA that is shown on the gel) written 5’->3’ direction?
5’-AGTCA -3’
5’-TACGGACTGA -3’
5’-AGTCAGGCAT -3’
5’-ATGCCTGACT -3’
5’-TCAGTCCGTA-3’
Homework Answers
I believe the correct answer to be:
Option C) 5’-AGTCAGGCAT -3’
As the 5' end is at the bottom and 3' incorporation is at the top of the gel.
feel free to leave a comment down below for any further query. good rating would be appreciated if you find my answer helpful. thank you.
Add Answer to:
A sample of DNA was sequenced using the dideoxy nucleotide
method, and the resulting (synthesized) products...
Pleaae answer this with explanation asap.I would really apprecuate it . 6. (4 points) Dideoxy sequencing...
Pleaae answer this with explanation asap.I would really apprecuate
it .
6. (4 points) Dideoxy sequencing of a fragment of DNA produces the gel pattern shown below, with the and+ to the left of the gel referring to the negative and positive electrodes of the gel, respectively. C T A G Which of the following statements about the gel products and the sequence of the DNA template are correct? The sequence of the template DNA is 5'-GACTCGACTGTACGTGC-3', te letter above...
ddATP ddCTP ddGTP ddTTP The autoradiogram shown was obtained from a DNA sequencing method called Sanger...
ddATP ddCTP ddGTP ddTTP The autoradiogram shown was obtained from a DNA sequencing method called Sanger sequencing or dideoxy sequencing. The arrow shows the direction of migration of the DNA samples during electrophoresis. Determine the sequence of the DNA template strand, in the 5' to 3' direction, from this data. 5' – CGTCAATTTAG
Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining...
Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat It with sodium bisulfite. If your original DNA sequence Is: ACAGTCCGTCGGAGCCTGCCAGTCGATCGCACCT and yum sequence after trearment reads ACAGTTCGTCGGAGCTTCTTAGTOSATCGCACTT. Which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) b.) When this DNA sequence is replicated, which of these methylations will be transferred...
Write true or false ______ 1. The DNA sequence of one human being is on average...
Write true or false ______ 1. The DNA sequence of one human being is on average 99.9% identical to another random human being. ______ 2. As of 2009, all living human beings have had their entire genome sequenced. ______ 3. The nucleotide bases present in a DNA sequence are A, U, G, C. ______ 4. Techniques that enabled scientists to clone genes were developed in the 1970s. ______ 5. A restriction enzyme is useful because it is a generic enzyme...
1. DNA Structure and Replication fill in the blanks. 10pts and , have two nitrogenous rings...
1. DNA Structure and Replication fill in the blanks. 10pts and , have two nitrogenous rings and are a. The bases, called direction and reads the b. DNA Polymerase synthesizes new DNA in the template DNA strand in the direction. c. DNA polymerases use -exonuclease activity to proofread newly synthesized DNA. Whereas, DNA Pol I uses _-exonuclease activity to remove RNA primers. d. The enzyme telomerase synthesizes using as a template. e. DNA Replication begins at the and two ,,...
Luestion 3 1 pts Review: You have the DNA that is radioactively labeled at the S'ends...
Luestion 3 1 pts Review: You have the DNA that is radioactively labeled at the S'ends of DNA as shown below. But you want DNA that is labeled only at one end of the DNA, not both ends. One of the other undergraduate students in the lab suggests that you use a restriction enzyme to cut the DNA, then electrophorese the DNA in an agarose gel, then cut out the region of the gel with radioactive DNA fragment you want,...
7.. In the controlled termination method of DNA sequencing, reading the gel from _____ gives the...
7.. In the controlled termination method of DNA sequencing, reading the gel from _____ gives the sequence in the _____ direction; _____ fragments that were terminated _____ in polymerization move faster down the gel a. bottom to top; 5′ to 3′; shorter; early b. top to bottom; 5′ to 3′; longer; early c. bottom to top; 5′ to 3′; longer; later d. top to bottom; 5′ to 3′; shorter; early e. bottom to top; 3′ to 5′; shorter; early 8....
I just need the answers to questions 2 and 3. My DNA ladder is in lane...
I just need the answers to questions 2 and 3. My DNA ladder is
in lane 2 with the yellow arrow pointing to it. Thanks!
Part 2: Gel purification and ration Gel Slice and PCR Product Preparation modified from IBSci.com instructions for gel and PCR clean-up system A. Dissolving the Gel Slice 1. Following electrophoresis, excise DNA band from gel and place gel slice in a 1.5ml microcentrifuge tube. 1b. Use an analytical balance to weigh gel slice. Record weight...
8. DNA cloning. The first DNA clone using recombinant DNA technology was human insulin, which was...
8. DNA cloning. The first DNA clone using recombinant DNA technology was human insulin, which was made in 1978. The insulin gene was inserted into a plasmid and the gene was transcribed and translated from the plasmid in E coll cells. Insulin is synthesized by ribosomes in human pancreatic cells. Insulin is synthesized as a longer polypeptide, which is then trimmed by proteases to make the mature chains A and B (see Fig. 2.17 on page 39 of your textbook)....
Questions 9-12 deal with SSR loci in Sam's genome. Remember that SSRs (simple sequence repeats) are...
Questions 9-12 deal with SSR loci in Sam's genome. Remember that SSRs (simple sequence repeats) are tandem (next to each other) repeats of short sequences (a few bp). Such tandem repeats are located at specific sites scattered throughout the genome. Individuals vary in the number of repeats at each site sites can have up to 100 repeats. Each locus with the same repeats is called an SSR ocus DNA was extracted from Sam's white blood cells and cut with a...
Pleaae answer this with explanation asap.I would really apprecuate
it .
6. (4 points) Dideoxy sequencing of a fragment of DNA produces the gel pattern shown below, with the and+ to the left of the gel referring to the negative and positive electrodes of the gel, respectively. C T A G Which of the following statements about the gel products and the sequence of the DNA template are correct? The sequence of the template DNA is 5'-GACTCGACTGTACGTGC-3', te letter above...
ddATP ddCTP ddGTP ddTTP The autoradiogram shown was obtained from a DNA sequencing method called Sanger sequencing or dideoxy sequencing. The arrow shows the direction of migration of the DNA samples during electrophoresis. Determine the sequence of the DNA template strand, in the 5' to 3' direction, from this data. 5' – CGTCAATTTAG
Eplgenetic modifications to DNA sequences end resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat It with sodium bisulfite. If your original DNA sequence Is: ACAGTCCGTCGGAGCCTGCCAGTCGATCGCACCT and yum sequence after trearment reads ACAGTTCGTCGGAGCTTCTTAGTOSATCGCACTT. Which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide) b.) When this DNA sequence is replicated, which of these methylations will be transferred...
1. DNA Structure and Replication fill in the blanks. 10pts and , have two nitrogenous rings and are a. The bases, called direction and reads the b. DNA Polymerase synthesizes new DNA in the template DNA strand in the direction. c. DNA polymerases use -exonuclease activity to proofread newly synthesized DNA. Whereas, DNA Pol I uses _-exonuclease activity to remove RNA primers. d. The enzyme telomerase synthesizes using as a template. e. DNA Replication begins at the and two ,,...
Luestion 3 1 pts Review: You have the DNA that is radioactively labeled at the S'ends of DNA as shown below. But you want DNA that is labeled only at one end of the DNA, not both ends. One of the other undergraduate students in the lab suggests that you use a restriction enzyme to cut the DNA, then electrophorese the DNA in an agarose gel, then cut out the region of the gel with radioactive DNA fragment you want,...
I just need the answers to questions 2 and 3. My DNA ladder is
in lane 2 with the yellow arrow pointing to it. Thanks!
Part 2: Gel purification and ration Gel Slice and PCR Product Preparation modified from IBSci.com instructions for gel and PCR clean-up system A. Dissolving the Gel Slice 1. Following electrophoresis, excise DNA band from gel and place gel slice in a 1.5ml microcentrifuge tube. 1b. Use an analytical balance to weigh gel slice. Record weight...
8. DNA cloning. The first DNA clone using recombinant DNA technology was human insulin, which was made in 1978. The insulin gene was inserted into a plasmid and the gene was transcribed and translated from the plasmid in E coll cells. Insulin is synthesized by ribosomes in human pancreatic cells. Insulin is synthesized as a longer polypeptide, which is then trimmed by proteases to make the mature chains A and B (see Fig. 2.17 on page 39 of your textbook)....
Questions 9-12 deal with SSR loci in Sam's genome. Remember that SSRs (simple sequence repeats) are tandem (next to each other) repeats of short sequences (a few bp). Such tandem repeats are located at specific sites scattered throughout the genome. Individuals vary in the number of repeats at each site sites can have up to 100 repeats. Each locus with the same repeats is called an SSR ocus DNA was extracted from Sam's white blood cells and cut with a...
Most questions answered within 3 hours.
-
To buy a new house you must borrow $155,000. To do this you take
out a...
asked 7 minutes ago -
Spacely Sprockets is evaluating the construction of a new plant
on land the company purchased for...
asked 57 minutes ago -
1. Consider a linear regression model of y on K regressors and
an intercept.
(i) Describe...
asked 58 minutes ago -
Enter a balanced equation for the reaction between hydrochloric
acid and sodium sulfite.
Express your answer...
asked 1 hour ago -
Give a regular expression describing the language
{x | x ∈ Σ* and x does not...
asked 1 hour ago -
Masses of 1.0 kg, 2.0 kg, and 3.0 kg are each separately subject
to a net...
asked 1 hour ago -
The mode of philosophical argumentation and thought. How do
philosophers think and write? What is important...
asked 1 hour ago -
At the beginning of the unit, you were asked whether you thought
it was appropriate or...
asked 1 hour ago -
Calculate the grams of carbon in 9.32 x 10+23 molecules of
benzene (C6H6).
asked 1 hour ago -
A 5-year Treasury bond has a 4.95% yield. A 10-year Treasury
bond yields 6.6%, and a...
asked 1 hour ago -
suppose you own a chain of five restaurants in
downtown Vancouver. as the manager, you want...
asked 1 hour ago -
Here are summary statistics for randomly selected weights of
newborn girls:
nequals=225x overbarxequals=28.7hg, sequals=7.5hg. Construct a...
asked 1 hour ago