Some coupled reactions in cells, including many involved in protein synthesis, use the nucleotide GTP as...
Some coupled reactions in cells, including many involved in protein synthesis, use the nucleotide GTP as an energy source instead of ATP. What would be the advantage of using GTP instead of ATP as an energy source for these cellular reactions?
Homework Answers
GTP require GTPase enzyme.These enzyme usually used in signaling. GTP act best with G- protein .Many hormones uses G-Protein to transmit signal here ATP cannot be used. G- Protein act best with GTP than ATP.Tubulin utilizes GTP to make microtubulin here ATP cannot be used same.
Add Answer to:
Some coupled reactions in cells, including many involved in
protein synthesis, use the nucleotide GTP as...
28.(2 pts) What are 2 types of protein assemblies that plant cells can use to translocate...
28.(2 pts) What are 2 types of protein assemblies that plant cells can use to translocate solute particles? 29. (2 pts) If the observed cellular concentration of an ion does not agree with the Nernst equation predicted level, what is one cellular mechanism that could be responsible? 30. (4 pts) What type of active transport directly uses ATP energy to pump a solute against its concentration gradient? Which type relies on a proton-motive force?
What is the critical difference between passive and active transport? A. passive requires energy but active...
What is the critical difference between passive and active transport? A. passive requires energy but active does not B. passive requires no energy, but active does C. passive and active each require energy, but passive requires less What is an enzyme? A. a protein that facilitates a reaction B. a protein that supplies water for hydrolysis reactions C. a protein that absorbs water during dehydration reactions The First Law of Thermodynamics states: A. energy can be changed from one form...
A3. The synthesis of sucrose from glucose and fructose is facilitated through the use of ATP...
A3. The synthesis of sucrose from glucose and fructose is facilitated through the use of ATP as an energy source. The reaction equations for the process, with their Gibbs energy signs, are shown below. glucose + fructose — sucrose ATP + H20 = ADP + Pi AG = Positive AG = Negative glucose + fructose + ATP> sucrose + ADP + Pi Overall AG = Negative Answer A, B, and C. A. The two reactions shown above the line are...
Sugars are used by many chemoheterotrophs as an important source of carbon and energy. Indeed, complete...
Sugars are used by many chemoheterotrophs as an important source of carbon and energy. Indeed, complete oxidation of glucose using oxygen as a terminal electron acceptor has a free energy change of -2,883.0 kJ/mol. What strategy do cells use to minimize the amount of that energy that is lost as heat during the catabolism of sugars? Choose one: A Energy is harvested using a series of smaller oxidations B. Oxidations of sugars directly power membrane-bound ATP synthases. C. The cells...
s141) Which nucleotide is used for energy to drive protein synthesis? A) TTP B) CTP C)...
s141) Which nucleotide is used for energy to drive protein synthesis? A) TTP B) CTP C) UTP D) GTP 2) Ribosomal RNA: A) Can bind to prokaryotic mRNA B) Plays no role in peptidyl transferase activity C) In eukaryotes, attaches to mRNA before transcription is completed D) All of the above 3) Spliceosomes: A) Are 40-60S, about the size of ribosomal subutnit B) Are necesssary for DNA replication C) Bind to RNA Polymerase D) Are composed entirely of proteins E)...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be...
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...
1. What are the different sources of energy available to living organisms? 2. How do the...
1. What are the different sources of energy available to living organisms? 2. How do the acquisition and the use of energy by living organisms work according to the laws of thermodynamics? 3. Explain the energy use in the following reactions: endergonic/exergonic. 4. What is metabolism? How are chemical reactions related to metabolism? Why is energy needed to run a metabolism? What are coupled reactions? 5. Draw a picture of ATP. Why is this molecule so important for cells? How...
We have seen all term that cells use the hydrolysis of high energy phosphate from ATP...
We have seen all term that cells use the hydrolysis of high energy phosphate from ATP to make metabolic reactions thermodynamically favorable. Whereas most enzymes that utilize ATP hydrolyze between the b and g phosphates (yielding ADP + Pi), some enzymes hydrolyze ATP between the a and b phosphates (yielding AMP and PPi). ∆G°’ of phosphate hydrolysis is -31 kJ/mol for ATP + H2O --> ADP + Pi, and ∆G°’ of phosphate hydrolysis is -46.5 kJ/mol for ATP + H2O...
Part A - The Vocabulary of Protein Protein is involved in a wide range of important...
Part A - The Vocabulary of Protein Protein is involved in a wide range of important body functions, so adequate intake of it is essential While low protein intake can cause malnutrition and certain health conditions, too much protein can cause health problems as well Match the words in the left column to the appropriate blanks in the sentences on the right. ► View Available Hint(s) Reset Help hormones 1. Proteins called aid the immune system in its fight against...
28.(2 pts) What are 2 types of protein assemblies that plant cells can use to translocate solute particles? 29. (2 pts) If the observed cellular concentration of an ion does not agree with the Nernst equation predicted level, what is one cellular mechanism that could be responsible? 30. (4 pts) What type of active transport directly uses ATP energy to pump a solute against its concentration gradient? Which type relies on a proton-motive force?
A3. The synthesis of sucrose from glucose and fructose is facilitated through the use of ATP as an energy source. The reaction equations for the process, with their Gibbs energy signs, are shown below. glucose + fructose — sucrose ATP + H20 = ADP + Pi AG = Positive AG = Negative glucose + fructose + ATP> sucrose + ADP + Pi Overall AG = Negative Answer A, B, and C. A. The two reactions shown above the line are...
Sugars are used by many chemoheterotrophs as an important source of carbon and energy. Indeed, complete oxidation of glucose using oxygen as a terminal electron acceptor has a free energy change of -2,883.0 kJ/mol. What strategy do cells use to minimize the amount of that energy that is lost as heat during the catabolism of sugars? Choose one: A Energy is harvested using a series of smaller oxidations B. Oxidations of sugars directly power membrane-bound ATP synthases. C. The cells...
DNA, Genes and Protein Synthesis Activity 13: Protein Synthesis is the process by which cells produce (synthesize) proteins. An overview of the process is shown in model 2 (below). Gone 2 Gene 1 Gene 3 DNA strand3 TRANSLATION Protein Trp Gly Model 2 ACTIVITY and QUESTIONS 1. Based on the information you can gather from model 1 complete the following sentences: a. The nucleotide Adenine (A) always pairs with the nucleotide b. The nucleotide Guanine (G) always pairs with the...
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...
1. What are the different sources of energy available to living organisms? 2. How do the acquisition and the use of energy by living organisms work according to the laws of thermodynamics? 3. Explain the energy use in the following reactions: endergonic/exergonic. 4. What is metabolism? How are chemical reactions related to metabolism? Why is energy needed to run a metabolism? What are coupled reactions? 5. Draw a picture of ATP. Why is this molecule so important for cells? How...
Part A - The Vocabulary of Protein Protein is involved in a wide range of important body functions, so adequate intake of it is essential While low protein intake can cause malnutrition and certain health conditions, too much protein can cause health problems as well Match the words in the left column to the appropriate blanks in the sentences on the right. ► View Available Hint(s) Reset Help hormones 1. Proteins called aid the immune system in its fight against...
Most questions answered within 3 hours.
-
A local
electronic company primarily manufactures four highly technical
telecommunication products. Each product must be processed...
asked 21 minutes ago -
•Describe the basic structure of collagen monomers •Explain how
amino acid composition of collagen contributes to...
asked 2 hours ago -
Compute the sample correlation coefficient
r for each of the following data sets.
(Use 3 decimal...
asked 2 hours ago -
5a. What are the advantages and disadvantages of Proxy ARP?
b. What is the TTL field...
asked 2 hours ago -
An ice cube (density = 900[kg/m3]) with a side length of
2.54[cm] is held by a...
asked 4 hours ago -
would you say that leaders in the international context are born
or made? That is, can...
asked 4 hours ago -
Instructions
Read the Digital Trends article "Solid state drives are speedier
than hard disk drives. Are...
asked 4 hours ago -
A multiple-choice test consists of 29 questions with possible
answers of a, b, c, d. Estimate...
asked 4 hours ago -
Question 1: Ethanol is the active ingredient of alcoholic
beverages. It is also s a possible...
asked 4 hours ago -
In the process of a simple distillation, the substances in the
still head tube are in...
asked 4 hours ago -
In a normal distribution with mean 3 and standard deviation of
7, what are the upper...
asked 5 hours ago -
A big block stone with mass M explodes and splits in two pieces
with mass 0.40M...
asked 5 hours ago