Which term refers to a point mutation that results in different amino acids in a particular...
Homework Answers
Add Answer to:
Which term refers to a point mutation that results in different
amino acids in a particular...
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino aci...
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...
Mutations Worksheet-Dcletlon, Inserilon & Substitution
Mutations Worksheet-Dcletlon, Inserilon & SubstitutionThere are several types of mutations:> DELETION (a base is lost/deleted)> INSERTION (an extra base is added/inserted)- Deletion\& insertion may cause what's called a FRAMESHIFT mutation, meaning the reading "frame"changes, thus changing the amino acid sequence from this point forward > SUBSTITUTION (one base is substituted for another)- If a substitution changes the amino acid, it's called a MISSENSE mutation- If a substitution does not change the amino add, it's called a SILENT mutation- If a...
3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the...
3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the transcript: AUU UCU VUA GCA AGA GCU... Al The corresponding amino acids in the normal CFTR protein are: (Use either the one-or three-letter amino acid codes A naint mutation changes the last nucleotide from U to C. At the DNA level, this is a transition transversion c) At the protein level, this is a (silent / missense / nonsense/frameshift ) mutation. D) Instead of...
Which of the following would result in the largest number of amino acids being changed? Select...
Which of the following would result in the largest number of amino acids being changed? Select one: a. Silent mutation b. Missense mutation c. Frameshift d. Triplet repeat
11. Match each type of mutation with the corresponding description. (4 points) Missense An insertion or...
11. Match each type of mutation with the corresponding description. (4 points) Missense An insertion or deletion of nucleotides that are not in multiples of 3. Nonsense A mutation that does not alter the protein sequence. Silent A mutation that confers an amino acid substitution. Frameshift A mutation that confers a premature stop codon.
Match each mutation with its appropriate description. A mutation that changes a codon that specifies an...
Match each mutation with its appropriate description. A mutation that changes a codon that specifies an amino acid to a stop codon, resulting in premature termination of polypeptide synthesis. Silent mutation Frameshift mutation A mutation that results in a change in a codon such that a different amino acid is specified es Missense mutation A mutation that changes one codon to a different codon that specifies the same amino acid, such that there is no change in the resulting polypeptide....
A wild type gene contains the DNA 3'CCG5' which would code for the amino acid glycine....
A wild type gene contains the DNA 3'CCG5' which would code for the amino acid glycine. A mutation changed the DNA to 3'TCG5' which would code for the amino acid serine. This is an example of which of the following? Group of answer choices A silent mutation A missense mutation A nonsense mutation A frameshift mutation None of these
2. If a mutation occurs and alters the sequence CGATATGA to CGATATCA what will be the...
2. If a mutation occurs and alters the sequence CGATATGA to CGATATCA what will be the final effect - compared to the protein that was supposed to be made, how would the actual protein that is synthesized (made) look -shorter, longer or same? 3. Give the sequence of the protein that would result from such a mutation (mutation in question 4. What is the name given to such a mutation? Be specific (answer is not point mutation, deletion, insertion, substitution...
Please answer all.... Thank you! 81)If a polypeptide chain contains 600 amino acids, then the gene...
Please answer all.... Thank you!
81)If a polypeptide chain contains 600 amino acids, then the
gene coding for this polypeptide must contain _____.
600 nucleotides
1200 nucleotides
1800 nucleotides
1800 codons
1800 anticodons
More than one of the above are correct.
82) When we altered gene triplet in the DNA produces a chain-terminating codon in the mRNA, the (1pts) result is called a reverse mutation nonsense mutation missense mutation spontaneous mutation frameshift mutation 83) A single base substitution changes the...
Question 6 6. (1pts) The following DNA sequence 5-AGTCGCCCATGCCG-3' undergoes a mutation in which an A...
Question 6 6. (1pts) The following DNA sequence 5-AGTCGCCCATGCCG-3' undergoes a mutation in which an A nucleotide is inserted at the 5' end of the molecule. How would you classify this mutation? Frameshift mutation Silent mutation Nonsense Mutation Missense mutation
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...
Mutations Worksheet-Dcletlon, Inserilon & SubstitutionThere are several types of mutations:> DELETION (a base is lost/deleted)> INSERTION (an extra base is added/inserted)- Deletion\& insertion may cause what's called a FRAMESHIFT mutation, meaning the reading "frame"changes, thus changing the amino acid sequence from this point forward > SUBSTITUTION (one base is substituted for another)- If a substitution changes the amino acid, it's called a MISSENSE mutation- If a substitution does not change the amino add, it's called a SILENT mutation- If a...
3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the transcript: AUU UCU VUA GCA AGA GCU... Al The corresponding amino acids in the normal CFTR protein are: (Use either the one-or three-letter amino acid codes A naint mutation changes the last nucleotide from U to C. At the DNA level, this is a transition transversion c) At the protein level, this is a (silent / missense / nonsense/frameshift ) mutation. D) Instead of...
11. Match each type of mutation with the corresponding description. (4 points) Missense An insertion or deletion of nucleotides that are not in multiples of 3. Nonsense A mutation that does not alter the protein sequence. Silent A mutation that confers an amino acid substitution. Frameshift A mutation that confers a premature stop codon.
Match each mutation with its appropriate description. A mutation that changes a codon that specifies an amino acid to a stop codon, resulting in premature termination of polypeptide synthesis. Silent mutation Frameshift mutation A mutation that results in a change in a codon such that a different amino acid is specified es Missense mutation A mutation that changes one codon to a different codon that specifies the same amino acid, such that there is no change in the resulting polypeptide....
2. If a mutation occurs and alters the sequence CGATATGA to CGATATCA what will be the final effect - compared to the protein that was supposed to be made, how would the actual protein that is synthesized (made) look -shorter, longer or same? 3. Give the sequence of the protein that would result from such a mutation (mutation in question 4. What is the name given to such a mutation? Be specific (answer is not point mutation, deletion, insertion, substitution...
Please answer all.... Thank you!
81)If a polypeptide chain contains 600 amino acids, then the
gene coding for this polypeptide must contain _____.
600 nucleotides
1200 nucleotides
1800 nucleotides
1800 codons
1800 anticodons
More than one of the above are correct.
82) When we altered gene triplet in the DNA produces a chain-terminating codon in the mRNA, the (1pts) result is called a reverse mutation nonsense mutation missense mutation spontaneous mutation frameshift mutation 83) A single base substitution changes the...
Question 6 6. (1pts) The following DNA sequence 5-AGTCGCCCATGCCG-3' undergoes a mutation in which an A nucleotide is inserted at the 5' end of the molecule. How would you classify this mutation? Frameshift mutation Silent mutation Nonsense Mutation Missense mutation
Most questions answered within 3 hours.
-
1. List the features used to classify leaf
types.
2. List some characteristics that are shared...
asked 1 minute from now -
The three elements of Value Proposition, Key Customers, and
Capabilities operate within an environment. Which of...
asked 33 seconds ago -
Katelynn, a physician, earns $200,000 from her medical practice
in the current year. She receives $45,000...
asked 8 minutes ago -
Each row of the table below describes an aqueous solution at
25°C
.
The second column...
asked 12 minutes ago -
A horizontal wire is at y = 0. Current travels in the +x
direction. The magnetic...
asked 12 minutes ago -
Let X be a continuous random variable whose PDF is Let X be a
continuous random...
asked 34 minutes ago -
Martinez Company’s relevant range of production is 7,500 units
to 12,500 units. When it produces and...
asked 32 minutes ago -
A football with a mass of 1.2 kg is kicked from ground level to
a height...
asked 37 minutes ago -
Remember: Changes in supply determinants shift supply, and
changes in demand determinants shift demand. We say...
asked 36 minutes ago -
Why is the answer b), for this question? I came up with C) for
my incorrect...
asked 42 minutes ago -
Suppose that you know that in the population of full-time
employees in the United States, the...
asked 1 hour ago -
This experiment was designed originally to sample various meat and carcass quality
aspects of Ontario pigs...
asked 1 hour ago