If the DNA samples dont show the same patttern and number of patterns in the gel electrophoresis that means the DNA samples that are taken are from two different individuals and the gene sequence is not same.
4. What could we say about the two DNA samples if they did not show the...
Gel Electrophoresis of Amplified PCR Samples 9. What is Alu? 10. Why is Alu useful for studying human ancestry? 11. Why do the two possible PCR products from our lab differ in size by 300 base pairs? 12. Explain how gel electrophoresis separates DNA fragments 13. Fill in the table below. For each genotype, write how many DNA bands (fragments) you would expect to see in a gel, along with the size of each (n base pairs) Table 1. Predicted...
NA fingerprinting uses a process called gel electrophoresis to separate the fragments of DNA. Once the DNA fragments are sorted, the pattern of bands can be analyzed. 1)Gel Electrophoresis Procedure The smaller DNA fragments start to move away from the wells and the larger DNA fragments remain closer to the wells. 2)An electric current is passed through the gel. 3) DNA fragments are treated with a dye. 4)A restriction endonuclease is added to the DNA. 5)Using micropipettes, the DNA samples...
Stuck answering the rest of
these
3. Application of DNA gel electrophoresis. DNA gel electrophoresis is commonly used in determining familial relationships among individuals, for ex; to establish paternity of a child. This technique is called DNA fingerprinting. In this technique the DNA of parents and children is roughly chopped up into pieces and resolved on an agarose gel. The DNA ill resolve according to their sizes and create a pattern or a "fingerprint". The fingerprint of the child is...
Day 1, You have isolated DNA from 30 individuals and performed
restriction enzyme digestion. You have loaded the product and run
the gel electrophoresis following the instruction properly. You
expected to see DNA bands after the procedure is completed, like
figure A, but after the completion of the run your gel looks like
figure B. You did not see any DNA band. You were so upset, but your
lab partner fixed the problem and your gel looked like figure A....
Question 4-12 points Biologists use gel electrophoresis to sont DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively chargod (with a charge of two electrons per base pair). When you "run the gel" you are generating an electric field by connecting anodes and cathodes at the ends of the gel This causes the negatively charged DNA segments to move towards the positive electrode. After nunning the gel, smaller DNA segments have moved...
A. Your lab To see if you understand what you did in our lab, answer the following based in the procedures for the restriction digest and the gel electrophoresis. 1. Using the PGLO map on p7 of the gel electrophoresis procedure, predict the size of the fragments generated by each enzyme EcoRI Hindill, and Pst! (the sizes you would expect to see on the gel.) (6 pts) Hindill -8 fragments were produced by the restriction enzyme. 2. Answer the calculation...
S Summeldild Du pole so that the DNA migrates to the center of the gel The size standard should be near the negative pole and the DNA wells near the positive pole so that the DNA migrates to the center of the gel None of the above are correct Question 4 1 pts You set up a gel with the correct DNA and size standards in the correct well. The wells are placed near the positive pole and you turn...
Human genomic DNA is around 3 billion bps. Why do we see a band around 10kb in 1% agarose gel electrophoresis? Did we do something wrong, damage the DNA and shorten it or something, what kb shall we expect to see it?
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
Question 1. 1 2 3 4 5 6 7 8 Lane Name/Code Ladder 1B | 2B 2 DNA Sample/Treatment DNA ladder Digest Digest Digest Digest Digest Digest 3B 4B 5B Negative Figure 1: 1% Super buffer agarose gel electrophoresis of restriction digest of the plasmid containing the gdhA gene insert. Based on the information above answer the following questions? 1. What ladder size used? 2. What are the two top bands and bottom bands representing? 3. Explain why the observed...