Can you help me with this question? 7. On Day 4, you will obtain your sequence....
pls help ?
Font Q10B. You would sequence a gene (5-CCGATTAAGGCTTAACTAACCGGTTAAGCG-3) with a reverse primer (5-CGCTTAACC-3) with radioactive labeled chain terminator nucleotides. Fragments were run on a polyacrylamide gel to read a sequence from 5 3' of the gene sequence. Fill each lane on the gel with bands which terminate with either A, C, G, or I nucleotide. Also, mark the size of the fragments in lane L. Write the complete sequences as you read off the gel. (5 points)...
If you wish to sequence a long strand of DNA in one round of reactions, you should: O A. Decrease the ddNTP/dNTP ratio O B. Increase the ddNTP/dNTP ratio O C. Use a shorter DNA primer O D. Add twice as much primer Based on this figure, the most likely error is: O A. The scientist forgot to add dNTPs to one of the reaction tubes. O O B. <label for="q7_4" id="lq7_4">The scientist did not denature the DNA strands</label> O...
The following diagram represents a replication bubble associated
with DNA synthesis. Based on this diagram, select all of the
options below that are true.
1 | 2 ---- Quadrants 1 and 4 are associated with lagging strand synthesis Quadrants 1 and 4 are associated with leading strand synthesis Quadrants 1 and 2 are associated with lagging strand synthesis Quadrants 3 and 4 are associated with lagging strand synthesis Synthesis of both daughter strands is completely continuous Telomerase activity is needed...
2) On your first day working in my lab, you obtain the following DNA sequence: 3' AATTATACACGATGAAGCTTGTGACAGGTTTCCAATCATTAA 5 5' TTAATATGTGCTACTTCGAACACTGTECCAAAGGTTAGTAATT 3' a) What are the two possible RNA molecules that could be transcribed from this DNA? Indicate the 5' and 3' ends of the RNA. b) Only one of these two RNA molecules can actually be translated. Explain why. c) It turns out that the RNA molecule that can be translated is the mRNA for p53. What is the amino...
NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS
WELL. THANKSSSSSSS
1. You want to clone a gene from a donor vector to a host vector. List the correct order of events in the process of cloning a. Perform ligation reaction of cloned gene and host vector. b. Perform double digestion of both donor and host vectors with the 2 restriction enzymes c. Examine donor and host vectors for restriction sites d. Purify cloned gene from donor vector...
Molecular Bio lab. HELP!!
Here is the first part: the sequence traces and the entire
sequence. i just need the last 3 tasks. i color coded the ends so
you can see where it overlaps and connects
In the files section for your group there is a simulated output from an automated DNA sequencer using a variation of the classic Sanger method. (If you want to print it, it is formatted for legal sized paper.) This sequence encodes a protein...
QUESTION 1: You are inserting a gene into an MCS found within the LacZ gene. Using blue/white colony selection, why could you assume that white colonies have modified plasmids? a. A blue colony means the LacZ reading-frame was disrupted b. A blue colony means your gene has mutations c. A white colony means the LacZ reading-frame is intact d. A white colony means the LacZ reading-frame was disrupted QUESTION 2: You are performing a PCR using primers with a sequence perfectly...
Please I need help on questions 1-4 in great detail please
Load 15 mu l of the following samples from the above section onto the simple Wells. Seal the wells with agarose and electrophorese until the bromophenol blue in the samples has migrated to within 2 mm of the positive electrode end of the gel. Remove the gels from the unit and stain them as described in Section IV. Measure the distance of the DNA bands (in cm) from the...
4. (1.5 pts)You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below. 5°-АсттсслтАTстсТАЛААТАССАТCGATСтстсссссстАGстAСCТААССАGAGACCСТАССG-3. 3-тслАсстатАсAGATTTTATсстасстаGлCAссссССATCCATCGAтTСстстстасGAТСCС-5. Markers part (a) part (b) part ck Right primer should anneal to this region Left primer should 87 nts anneal to this region 80 nts 70 nts 60 nts 50 nts 40 nts 27 nts Draw into the following gel lanes what size(s) of PCR products you would get if you...
Just be need help with #4
er your nandwriting must be egible order to receive dealt onee answers must be presented in a logical, and sequential manner. Do your explanation should be detailed enough for me to understand how things are rela not expect me to assume anything ing questions pertain to the polypeptide chain ill need to be very Descriptive Answer Number 1 worth 50 points. The follow drawn below. You will want to answer these questions on your...