Question

4. (1.5 pts)You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below. 5°-АсттсслтАTстсТАЛААТАССАТCGATСтстсссссстАGстAСCТААССАGAGACCСТАССG-3. 3-тслАсстатАсAGATTTTATсстасстаGлCAссссССATCCATCGAтTСстстстасGAТСCС-5. Markers part (a) part (b) part ck Right primer should anneal to this region Left primer should 87 nts anneal to this region 80 nts 70 nts 60 nts 50 nts 40 nts 27 nts Draw into the following gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above. (a) 5'-ACTTCGATATGTCTAAAATAC-3' and 5'- CGGTAGCGTCTCTGGTTAGCT -3' (b) 5'-TGAAGCTATACAGATTTTATG-3' and 5'-GCCATCGCAGAGACCAATCGA-3' (c) 5'-GTATTTTAGACATATCGAAGT -3' and 5'-AGCTAACCAGAGACGCTACCG-3'

Answer 1

Markers Ca) 6) (0) 87 80 70 64 60 50 40 27 nt

Primers in the group (a) can able to do the extension of DNA sequence and give PCR products with 64 nucleotides.

Primera in the group (b) cannot do extension of DNA sequence. So gel run after PCR gives original DNA sequence 64 nucleotides (without amplification so pale band) and primer size 21 nucleotides.

Primers in the group (c) also produce similar result as the group (b)