Homework Answers
Answer
Question 4
A) 25% chances of having a child with O blood group . Ie; Out of 4 children one will have O blood group
B) AB blood group- 25%
B blood group- 25%
A blood group- 25%
O blood group- 25%
(25% means 1 out 4 child have Particular blood group)
Explanation please find from the below attachment
According to HomeworkLib guidelines and write in the comment box that I am only supposed to answer 1st Question (in case of multiple Questions) or first 4 (in case multiple subparts). Kindly post the questions seperately if you want answer to all the questions. Or if you have any specific doubt I can answer in the comment. Sorry for the inconvenience.
Hope it will helpful to you. Thankyou
All the best
Add Answer to:
4. A) Please use Punnett square to explain how a couple with type A and type...
16. Which of the following enzymes adds DNA to the ends or material with duplication? a....
16. Which of the following enzymes adds DNA to the ends or material with duplication? a. Telomerase b. Polymerase d. Primase e. Ligase 1. Which of the following structures indicates where DNA replication begins a. DNA polymerase III b. Replication fork C. Helicase d. Origin of replication e. Centromeres 18. A select mutation is causing a cell lineape to be unable to replicate DNA SUccessfully NA successfully. When observed under a microscope, researchers observe that the DNA is able to...
please explain and show punnett square solution A child is born to a couple, one of...
please explain and show punnett square solution
A child is born to a couple, one of whom is heterozygous for an autosomal dominant disease. The other parent is homozygous normal. What would be the child's chances of having the disease? (Hint: use a Punnett square to figure this out). 0% 25% C. 50% 75% A child is born to a couple, one of whom is heterozygous for an autosomal recessive disease The other parent is homozygous normal. What would be...
Please match the vocabulary words on the left side with the definitions on the right. the...
Please match the vocabulary words on the left side with the
definitions on the right.
the vocabulary word to the definition antiparallel A basic form of DNA in a double-stranded spiral chromatin B. a family of enzymes that catalyze the elongation of new DNA strands proteins that bind to DNA forming spools around which the DNA can be wound to form chromosomes DNA polymerase DNA replication D. short lengths of DNA that are made during DNA replication to make the...
Please place your answer on the form, thanks Assignment 4 Here is a straightened DNA double...
Please place your answer on the form, thanks
Assignment 4 Here is a straightened DNA double helix. I don't know which one is the coding strand and which is the template strand. Can you figure it out? Determine and indicate by arrow which strand is the coding strand, and transcribe and translate it. Hint: find the start codon in the proper 5'-3' direction 3 TACGTGATA GATCGATCATCCGAGACT 5 C5' ATGCACTATCTAGATAGTAGGCTCTGA 3 "S Transcribed mRNA w er rens Translated Protein
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
PLEASE HELP WITH TABLE.thank you 1.Select the coding strand, and select the template strand from the...
PLEASE HELP WITH TABLE.thank you
1.Select the coding strand, and select the template strand from
the answers below. (Select more than 1 answer)
The coding strand is the first strand running from 5' to 3'.
The coding strand is the second strand running from 3' to
5'.
The template strand is the second strand running from 3' to
5'.
The template strand is the first strand running from 5' to
3'.
2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...
1) Using the word bank - Conservative, anti-parallel, complementary, parallel, semi-conservative, please answer the questions. A)...
1) Using the word bank - Conservative, anti-parallel, complementary, parallel, semi-conservative, please answer the questions. A) One stand of DNA runs in the 3' to 5' direction. Its matching strand runs in the opposite direction, 5' to 3'. This is because 2 strands of DNA in a double-helix are: B) According to Chargaff's rule, A always bonds to T and C always bonds to G. The bonding of base pairs is: C) When DNA is replicated, the two original strands...
Question 25 4 pts Which of the following terms are associated with the discontinuously replicated strand...
Question 25 4 pts Which of the following terms are associated with the discontinuously replicated strand during DNA replication? I. DNA ligase II. Okazaki fragments III. lagging strand IV. leading strand V. RNA polymerase O I, II, III O I, II, III, V O II, IV, V O I, II, IV, V O II, III, V 4 pts Question 26 4 pts Which of the following aids in recruitment of RNA polymerase to a promoter of a gene to initiate...
4. Given the following information: One strand of a section of DNA isolated from E. coli...
4. Given the following information: One strand of a section of DNA isolated from E. coli reads 5’-GTAGCCTACCCATAGG-3’ 3’ CATCGGATGGGTACC’5 Suppose that an mRNA is transcribed from this DNA using the complementary strand as a template. What will the sequence of the mRNA in this region be (please include orientation)? How many different polypeptides chains could potentially be made from this sequence of RNA? Would the same polypeptide chains be made if the other strand of the DNA...
16. Which of the following enzymes adds DNA to the ends or material with duplication? a. Telomerase b. Polymerase d. Primase e. Ligase 1. Which of the following structures indicates where DNA replication begins a. DNA polymerase III b. Replication fork C. Helicase d. Origin of replication e. Centromeres 18. A select mutation is causing a cell lineape to be unable to replicate DNA SUccessfully NA successfully. When observed under a microscope, researchers observe that the DNA is able to...
please explain and show punnett square solution
A child is born to a couple, one of whom is heterozygous for an autosomal dominant disease. The other parent is homozygous normal. What would be the child's chances of having the disease? (Hint: use a Punnett square to figure this out). 0% 25% C. 50% 75% A child is born to a couple, one of whom is heterozygous for an autosomal recessive disease The other parent is homozygous normal. What would be...
Please match the vocabulary words on the left side with the
definitions on the right.
the vocabulary word to the definition antiparallel A basic form of DNA in a double-stranded spiral chromatin B. a family of enzymes that catalyze the elongation of new DNA strands proteins that bind to DNA forming spools around which the DNA can be wound to form chromosomes DNA polymerase DNA replication D. short lengths of DNA that are made during DNA replication to make the...
Please place your answer on the form, thanks
Assignment 4 Here is a straightened DNA double helix. I don't know which one is the coding strand and which is the template strand. Can you figure it out? Determine and indicate by arrow which strand is the coding strand, and transcribe and translate it. Hint: find the start codon in the proper 5'-3' direction 3 TACGTGATA GATCGATCATCCGAGACT 5 C5' ATGCACTATCTAGATAGTAGGCTCTGA 3 "S Transcribed mRNA w er rens Translated Protein
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
PLEASE HELP WITH TABLE.thank you
1.Select the coding strand, and select the template strand from
the answers below. (Select more than 1 answer)
The coding strand is the first strand running from 5' to 3'.
The coding strand is the second strand running from 3' to
5'.
The template strand is the second strand running from 3' to
5'.
The template strand is the first strand running from 5' to
3'.
2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...
Question 25 4 pts Which of the following terms are associated with the discontinuously replicated strand during DNA replication? I. DNA ligase II. Okazaki fragments III. lagging strand IV. leading strand V. RNA polymerase O I, II, III O I, II, III, V O II, IV, V O I, II, IV, V O II, III, V 4 pts Question 26 4 pts Which of the following aids in recruitment of RNA polymerase to a promoter of a gene to initiate...
Most questions answered within 3 hours.
-
how
does gravity affect the trajectory of projectile? what would be the
shape of the trajactory...
asked 9 minutes ago -
Two small plastic spheres are given positive electrical charges.
When they are a distance of 15.4...
asked 16 minutes ago -
An acidic solution containing gold ions is
electrolyzed, producing gaseous oxygen (from water) at the anode...
asked 32 minutes ago -
Assume that the population of Mexico is 128
million and that the population increases 1.01
percentannually....
asked 1 hour ago -
Can someone please help me add appropriate descriptive
comments to each line of code in the...
asked 1 hour ago -
Romeo wishes to throw a bouquet of flowers to Juliet, who is on
a second-story balcony,...
asked 2 hours ago -
Why is QE a controversial monetary policy tool.
A. It may lead to excessive inflation.B. By...
asked 2 hours ago -
Principles of Programming midterm study guide help!
1.)
______ Which of the following would reference the...
asked 2 hours ago -
A finite potential well has depth U0 = 2.78 eV . What is the
penetration distance...
asked 3 hours ago -
1. The bus bars of a power station are in two sections A and B
separated...
asked 3 hours ago -
Fiscal policy is the deliberate manipulation of taxes and
government spending to alter GDP, employment, inflation...
asked 4 hours ago -
evaluating an expression using only one digit and + and - as
operators ....3+5-1+7-5+8
-----------------------
stack...
asked 4 hours ago